Bio-Information

National AIDS Reserach Institute Pune : Walk in Interview (Senior Research Assistant) 12 November 2010

2010-11-05T08:07:00.000+05:30

Application is invited for walk in Interview for the following posts under ‘HIV Sentinel Surveillance project’ These posts are purely temporary and are to be filled on year to year basis for the duration of the project.

Name of Post : Senior Research Assistant (Lab)
Number of Post : 01
Consolidated Salary Rs.13,035/-
Qualification Required : M.Sc. in Biotechnology / Microbiology
Desired Experience : Experience in immunological and virological assays
Date of Reporting : 12 November 2010 (09.00 am)

Walk in with your application on plain paper, enclose full bio data and a set of an attested photocopies of proof of age, educational qualification mark sheets, degree certificates, experience letters etc. along with a cross Demand Draft for Rs.25/-drawn in favor of Director National AIDS Research Institute 73, ‘G’ Block MIDC, Bhosari, P.B. 1895, Pune 411026.

Government servants should apply through proper channel. Director, NARI reserves the right to shortlist the candidates to be interviewed. Any canvassing by or on behalf of the candidates or bringing political or other influence with regards to selection shall be considered as a disqualification. Age and experience is relaxable in deserving cases.

Postdoctoral Position in Population / Evolutionary Genetics, South Africa

2010-09-19T10:53:00.000+05:30

A postdoctoral position is available in the Aquaculture Division, Department of Genetics, Stellenbosch University with the focus on Genetic Diversity and Population Structure of farmed kob, Argyrosomus

japonicus and Argyrosomus inodorus, and the potential genetic impacts of farmed fish on associated wild fish populations. This project is a collaborative effort with Marine and Coastal Management (Dr Brett Macey)
and the University of Pretoria (Prof Paulette Bloomer).

Exciting new industry initiatives are presently underway that are exploring the culture potential of indigenous marine finfish in South Africa. Two such species currently under investigation are the dusky kob Argyrosomus

japonicus and silver kob A. inodorus. The proposed cage farming operations along the South African coastline have, however, raised concerns from both the [public] and conservation management authorities
about the potential genetic impacts of farmed fish on wild populations.

The current project is therefore aimed at the identification of populations or stocks along the southern African coast followed by the establishment of a broodstock management programme that can assist in

the appropriate placement of farms and hatcheries as well as and minimize the potential negative genetic impact of farmed animals on wild fish populations.
The successful candidate will primarily be responsible for:
1) The development of molecular genetic markers that enable the detection of fine-scale patterns of genetic variation in populations
with potentially shallow genetic sub-structure.
2) The identification of populations/stocks of A. japonicus and A. inodorus
along the southern African coast based on species-specific
microsatellites.
3) Assisting with the formulation of recommendations for kob farming along the South African coast.
Minimum requirements:
PhD with specialization in Population and/or Evolutionary Genetics or any closely related discipline. Candidates should have proficiency in the relevant population analysis software packages and experience with
microsatellite data will be an added advantage. The ideal candidate should also have proven project management experience and ability to set deadlines and meet milestones.
Closing date: 26 September 2010

Postdoc/Researcher in Bioethanol Production, Denmark

2010-09-19T10:45:00.000+05:30

The Bioenergy Group at DTU Environment is conducting research and development within bioconversion of organic matter to biofuels and bioenergy. Our activities are organized in several sub-groups, such as

biogas, microbial fuel cells, biohydrogen and bioethanol.

Job description:

We are seeking a competent Postdoc/Researcher to carry out research, supervise and organize the activities in the bioethanol group. We are conducting research with production of ethanol production from

lignocellulosic biomass. Our activities include hydrothermal pretreament, enzymatic hydrolysis and fermentation.
Qualifications: Candidates for the position should have academic qualifications equivalent to the PhD level within biotechnology, biochemical engineering, microbiology or bioprocess technology.

Also candidates should have very strong background (documented by both teaching and research) in lignocellulosic bioethanol production (pretreatment, hydrolysis, and fermentation,analysis of biomass composition). Research experience should be demonstrated by number of relevant publications in area of bioethanol and other biofuels, and with documented supervision of PhD students and master students.

Further information:
Further information may be obtained from Researcher Dimitar Karakashev, dbka@env.dtu.dk
Application Deadline: 1 October 2010.

Further fellowship details and application

JRF/SRF/RA posts vacant at Calcutta University | M.Sc/PhD's can send E - Resume

2010-04-03T20:16:00.000+05:30

Applications with testimonials are invited from eligible candidates to work in the Project entitled“Chemical and Pharmacological investigation of Indian Marine poisonous fishes” funded by Ministry of Earth Sciences, Govt of India under the guidance of Prof. Jharna Ray, S. N. Pradhan Centre for Neurosciences,CU. Project involves extensive field work and handling poisonous fishes.

Position: Junior Research Fellow

Qualification: M. Sc. in any stream of Biological Sciences and preferably NET/GATE Qualified

Fellowship: Rs.12,000 per month

Position: Senior Research Fellow

Qualification: M. Sc. in any stream of Biological Sciences with 2-3 years of research experience and documented by publications

Fellowship: Rs. 16,000 per month

Position: Research Associate

Qualification: PhD in Life Sciences supported with publications Salary: Rs. 16,000 per month

Tenure: Duration of the project is upto March 2012.

Last date for receiving applications is April 16, 2010

Contact person: Prof. Jharna Ray, S. N. Pradhan Centre for

Neurosciences, C.U. 244B, A.J.C. Bose Road, Kolkata –700 020 and 35,

Ballygunge Circular Road, Kolkata –

700 019

e-mail: jharnaray@gmail.com

View Original Notification

Germany live projects-The Bioinformatica Solutions

2010-03-12T17:39:00.000+05:30

Dear Students,

We have recently returned from Rostock University, Germany and have some collaborative projects on miRNA and Cancer. In case you are interested to work on the live project, let me know. I will discuss in detail about the project. The Bioinformatica Solutions will also assist you to for the jobs and admission in Germany.

We are pioneer in Lucknow for the quality project work in the advance field of Bioinformatics. We have already guided many project/dissertation in the area of Vaccine design, siRNA design, Gene identification, Drug designing, Genomics, Proteomics, QSAR modeling, Metabolomics, Chemo-informatics, Toxico-informatics and System Biology. Apart from these researches oriented areas we are also providing our expert guidance in Bioperl, Biopython, .net technologies for industrial projects.

We have strong team of experts in Bioinformatics who assist you throughout the project development life cycle. We normally identify the problem as per your research interest so that good publication may come up only in the dissertation period.

We have already trained more than 200 students from almost all part of India and most of them already selected in research labs of international repute. This time also, we are getting number of application for 1-6 month dissertation work during their MSc,M.Tech,B.Tech,workshop & summer & winter vacation. As we have very limited seats, we recommend you to kindly register yourself as early as possible.

Our new batch is going to start from 1st of April 2010.

We will be happy to answer all your queries regarding project / dissertation work/ training.
Good Luck.

www.thebioinformatica.com

Data Manager, BIOINFORMATICS @ Queen Mary School

2009-07-16T10:23:00.000+05:30

RESPONSIBILITIES:

A position is available in the Cancer Genomics Group for an experienced Data Manager. The appointee will be a member of the Institute of Cancer and the Cancer Research UK Centre at Barts and the London’s School of Medicine and Dentistry, and will be based at the Charterhouse Square Campus in the City of London. The appointee will be responsible for organising and assisting with all the cancer genomics studies undertaken by the group. This will involve data generated by new state-of-the-art array technology including high throughput sequencers (454-Roche and Illumina).

REQUIREMENTS:

They should have experience/working knowledge in management of large data sets. Working knowledge of UNIX is essential. Experience with high throughput sequencing data would be an advantage. Opportunities will exist for further involvement in this exciting area.

TERMS:
This is a fixed-term post until 30 September 2011.

SALARY & BENEFITS:

Future funding of the post is determined by performance reviews of the entire programme by Cancer Research UK. Appointment will be made on the Professional Grade 4 scale, with a starting salary in the range of 30,079-33,492 GBP per annum (inclusive of London Allowance), depending on experience. The benefits package for this post includes 30 days annual leave plus 4 College closure days; a contributory final salary pension scheme and an interest free season ticket loan.

HOW TO APPLY:

For an application form and further information, please visit the Human Resources website on http://www.hr.qmul.ac.uk/vacancies, or request details (quoting reference number 09280/MB) via email csq-recruit@qmul.ac.uk. Applicants wishing to make a non-electronic application may contact our 24 hour recruitment line on 020-7882 6149 for details.

DEADLINE:

The deadline for return of completed application forms is 5pm (GMT) on 31st July 2009. Forms should be returned via email to csq-recruit@qmul.ac.uk. For alternative means of applying, please contact the Recruitment Office. Applications must not be sent directly to the Centre for Medical Oncology.

Promoting excellence in teaching, learning and research
Valuing Diversity and Committed to Equality

Scientific Programmer @ European Bioinformatics Institute--Cambridge

2009-07-16T10:20:00.000+05:30

RESPONSIBILITIES:

We are looking for an experienced scientific programmer to produce software implementing techniques, explored in an existing project, in a manner that is suitable for use within production environments. S/he will also provide initial support to users.

The scientific programmer will produce, test, document, maintain, distribute and support code implementing a new statistical method called "AYB" - (see http://www.ebi.ac.uk/goldman/AYB) which has been developed at the EBI. This method analyses data from high-throughput sequencing systems; specifically, the base-calling component of the Illumina GA pipeline. In addition, the postholder should combine these duties with research into further development of the AYB methodology. The scientific programmer will report to the AYB project leaders at the EBI and will collaborate with scientists at EBI and other research institutes. Some travel, including international, is expected in the user support role.

REQUIREMENTS:

The successful candidate will have a first degree in a highly numerate subject such as maths, statistics, computer science or engineering and a relevant post-graduate qualification would be advantageous. S/he will have a minimum of 3 years experience of software engineering, including successful completion of multiple projects and have proven ability to implement complex numerical methods in robust, easy to use software suitable for non-experts. Experience of development of novel computationally-intensive data analysis methods would also be advantage as would experience of working in a research environment.

It is essential that the scientific programmer has experience of C/C++ programming and software engineering (build systems, version control, unit testing), on both Windows and Unix platforms and have informal experience with several distinct programming language families. Other languages would also prove highly beneficial.

The ideal candidate will have excellent communication both written and oral and interpersonal skills and have the ability to work within a small team, seeking advice from others when needed.Experience of providing user support (helpdesk/e-mail/in person) would be highly desirable.

TERMS:
An initial contract of 2 years will be offered to the successful candidate. This can be renewed, depending on circumstances at the time of review.

LOCALE:
European Bioinformatics Institute, Cambridge, United Kingdom.

SALARY & BENEFITS: Competitive.

HOW TO APPLY:
For further information please visit http://www.ebi.ac.uk/goldman/jobs.html , http://www.embl.org/ and http://www.ebi.ac.uk/. To apply, please email a cover letter, CV (in English) and contact information of three professional references quoting ref. no. AC/09/058/EBI in the subject line, to: applications@ebi.ac.uk.

DEADLINE: July 26, 2009

EMBL is an inclusive, equal opportunity employer offering attractive conditions and benefits appropriate to an international research organisation. Please note that special visa requirements apply to persons from countries outside the EU coming to work at EMBL-EBI in the UK. This period of work will not count as qualifying time in the Highly Skilled Migrant Programme.

BIOINFORMATICIAN @ Cancer Research UK--Cambridge

2009-07-16T10:16:00.000+05:30

BACKGROUND:

The Cambridge Research Institute (CRI) is a major new initiative of Cancer Research UK, in collaboration with the University of Cambridge. Strategically situated on the Addenbrooke�s biomedical campus, the Institute emphasises a multi-disciplinary approach linking the laboratory to the clinic to solve problems associated with the prevention, diagnosis and treatment of cancer.

The Bioinformatics Core facility provides computational support for research at CRI through statistical data analysis, data management, and training and consultation services, focussing primarily on high-throughput genomics technologies.

RESPONSIBILITIES:

We are seeking a bioinformatician to join our growing team and support microarray and next generation sequencing based projects. You will work closely with scientists on a regular basis analyzing data generated by our in-house Illumina genomics platforms for a range of applications including differential gene expression, ChIP analysis of DNA-bound proteins, SNP detection, copy number analysis and structural variation. You will also gain experience in experimental design and downstream analysis techniques, such as identifying gene signatures and regulatory networks.

REQUIREMENTS:

You should have a first degree in a scientific or computational discipline and preferably a postgraduate degree or significant experience in Bioinformatics or Computational Biology. The role requires good communication skills, as you will work closely with research scientists and other bioinformaticians, and the ability to work well in a team. You should also have programming skills and knowledge of bioinformatics software and data resources would be an advantage.

PREFERENCES:

The ideal candidate will have experience in the use of statistical methods and/or computational packages for analysing microarray data, especially using R and associated Bioconductor packages.

LOCALE: Cambridge, UK

SALARY & BENEFITS: £26,150 - £36,150 pa inclusive

HOW TO APPLY:
Please apply online at https://jobs.cancerresearchuk.org/

DEADLINE: July 24, 2009

Research Scientist

2009-07-13T15:02:00.000+05:30

BACKGROUND:

Vertex Pharmaceuticals Incorporated is a global biotechnology company committed to the discovery and development of breakthrough small molecule drugs for serious diseases. The Company's strategy is to commercialize its products both independently and in collaboration with major pharmaceutical companies. Vertex's product pipeline is focused on viral diseases, cystic fibrosis, inflammation, autoimmune diseases, cancer, and pain. The Knowledge Management group is developing systems to acquire, integrate, and interpret the critical internal and external information sources that enable drug discovery and development.

RESPONSIBILITIES:

The group currently seeks a Research Scientist to assist in assembling a knowledge engineering infrastructure and incorporate unstructured text data into its knowledge base.

Collect, or if necessary create, ontologies and thesauri relevant to Vertex’s scientific and business interests.
Assemble computational components to develop a natural language processing engine.
Incorporate text mining capability into workflows or automated pipelines to address questions encountered in drug discovery and development.
Build a knowledgebase of results obtained through text mining
Work with functional groups throughout the company to identify applications for text mining systems.

REQUIREMENTS:

A higher degree (preferably a Ph.D.) in biomedical sciences and a thorough knowledge of information sources that are important for drug discovery and development. In addition, 2-3 years of experience working in the text mining area and familiarity with major text mining technologies and applications, such as biomedical ontologies, RDF, SPARQL, OWL, UMLS, MetaMap, Linguamatics, Taverna, etc.

LOCALE: Cambridge, MA

HOW TO APPLY:
See http://careers.vrtx.com/ and search for keyword "mining".

DEADLINE: Open until filled

Software Engineer, Graphical User Interface (GUI)

2009-07-13T15:00:00.000+05:30

BACKGROUND:

The J. Craig Venter Institute (JCVI), a dynamic, world-leading scientific research institute based in Rockville, MD, is expanding its award-winning software team. Our ongoing success requires that we hire only the most enthusiastic and talented software engineering and bioinformatics professionals. If you are an energetic and creative individual interested in joining a fast-paced, team-centered environment, please consider the career opportunities listed below. (Principals only – no 3rd party agencies).

RESPONSIBILITIES:
- Designs and develops optimized/cross-platform user interface in CSS, HTML, JavaScript, and AJAX.
- Develops prototypes, mock-ups, storyboards, and provides HCI (Human-Computer interaction) design support for various web and scientific applications.
- Designs, implements and maintains n-tiered applications supporting scientific research and cutting edge data visualization using Web.
- Works cooperatively with other staff to achieve Venter Institute’s research goals.

REQUIREMENTS:
- BS or MS in computer science or software engineering or equivalent
- 3+ years experience in GUI development and data visualization in web or scientific applications using HTML, CSS, Javascript, AJAX and Flash.
- Ability to collaborate across a multi-disciplinary team, and work independently.

PREFERENCES:
- Knowledge and experience of Java, JSP, Spring/Struts, Tiles and Servlets.
- Bioinformatics experience or significant experience in other complex scientific domain
- Experience with Asynchronous and Service Oriented Architectures/Web Services
Swing, Applets, Flash, XML, SQL, Perl-cgi, C/C++
- Web Server or J2EE Application Server experience, specifically Tomcat or JBoss
- Development in mixed environment of Windows and Linux.

SALARY & BENEFITS:
JCVI offers an excellent working environment and a competitive benefits package.

HOW TO APPLY:
For more info or to apply, visit our web site at http://www.jcvi.org/. Equal Opportunity Employer M/F/D/V.

PH.D Position in System Biology

2009-07-13T14:55:00.001+05:30

BACKGROUND:

Mississippi State University Institute for Digital Biology (IDB) is a unique multidisciplinary institute dedicated to excellence in research, education and service in the analysis of the function and expression of genes with an emphasis on economically important species. We focus on collaborations across disciplines to increase our understanding of complex biological systems related to health, energy, the environment, and food and agriculture using a systems biology approach. The IDB provides undergraduate and graduate students with a unique opportunity to learn and conduct research in a cross disciplinary environment addressing problems of critical importance.

RESPONSIBILITIES:

IDB is currently offering two Ph.D. positions in computational Systems Biology. The Ph.D project involves working with an ongoing research program to develop systems biology resources for agricultural species using bio-ontologies and next generation sequencing technologies. The applicant will work with an established and productive team of multidisciplinary researchers to design and build computational resources that facilitate biological modeling of high throughput “omics” datasets. In addition to the PhD the applicant will be eligible to work towards a post graduate certificate in computational biology.

REQUIREMENTS:

Applicants are expected to either have taken and done well in mathematics through differential equations and linear algebra, statistics, computer science; or have a Masters degree in computer science focusing on bioinformatics or have a bioinformatics degree/masters degree. Must be able to program well in C++ or Perl.

PREFERENCES:

Experience with PERL, R and Matlab is desirable. Course work in genetics and cell & molecular biology would be beneficial.

LOCALE: Mississippi State, MS, USA

SALARY & BENEFITS:

The successful applicant will receive a stipend of $20,000-$24,000, depending upon qualifications. Partial tuition credit is included.

HOW TO APPLY:
Please send resume, 3 letters of reference and a statement of purpose to nanduribindu@gmail.com

DEADLINE: August 15, 2009

PhD Scientist, BIOINFORMATICS Job @ Schering-Plough--Singapore

2009-07-13T14:54:00.000+05:30

BACKGROUND:

Schering-Plough is establishing a Translational Research Laboratory (TRL) in the Biopolis in Singapore. The focus of the TRL will be on the discovery and development of biomarkers and imaging technologies as an integral part of the drug development process, in support of Schering-Ploughs global research efforts.

RESPONSIBILITIES:

The successful candidate will set up and execute Bioinformatics as part of the Molecular Profiling section. He/She will generate experimental designs, statistically analyze data obtained from genomics, transcriptomics, proteomics and metabolomics studies, and translate the findings to facilitate biological interpretation. The role will include close interaction with Global Informatics colleagues within SPRI, representing the TRL.

REQUIREMENTS:
Education: Minimal education required for this job Ph.D.

Skills: Ph.D. in Bioinformatics or a related Life Science discipline with a minimum of 3 years post PhD experience and a proven track record in applied bioinformatics analysis of gene expression microarray and mass spectrometry data, including pathway analyses.

TERMS:
Employment Type: Regular, Full-Time. Work Schedule: Day.

HOW TO APPLY:
Please visit: http://www.schering-plough-jobs.com/job/SINGAPORE,-SINGAPORE-PhD-Scientist-Bioinformatics-(Singapore)-Job/531823/

Postdocs and Engineers @ Penn State and Emory--University

2009-04-22T12:27:00.000+05:30

BACKGROUND:

The Galaxy Team at Penn State and Emory (http://galaxyproject.org) is looking for ambitious individuals to fill multiple postdoctoral and software engineering positions. Galaxy is used by thousands of researchers worldwide on a daily basis and multiple institutions run local instances of our software. Because Galaxy is primarily a tool and data integration framework, it is ideally suited by analysis of next-generation sequencing (NGS) data.

Galaxy is an open source project committed to the openness of scientific enterprise. It is free for all.

RESPONSIBILITIES:

The advertised jobs will focus extensively on design of best practice workflows for biological applications of NGS data including re-sequencing, de novo assembly, metagenomics, transcriptome analysis and epigenetics. Our current level of funding provides good job security and our project is well known, enabling excellent possibilities for subsequent career choices.

HOW TO APPLY:
To apply, e-mail cover letter, resume that includes highlights of your biological or software development experience, and contact information for three references to (jobs@galaxyproject.org).

Senior Research Investigator BIOINFORMATICS

2009-04-22T12:26:00.000+05:30

RESPONSIBILITIES:

The successful applicant will collaboratively work with Therapeutic Area biology metabolic and cardiovascular diseases, Immunology and Oncology diseases, Toxicology, and Clinical Discovery groups within the BMS Research and Development. He or she will use their advanced knowledge of Biology, Computer Science and Statistics to validate drug targets and drug candidates in the BMS discovery and development pipeline using cutting edge bioinformatics and genomics technologies. Responsibilities also include establishing and maintaining close collaborative relationships with other groups in R&D and educating biologists across the PRI in the use of Genomic methods and tools.

REQUIREMENTS:

Qualified candidates must have a Ph.D. in the Natural Sciences with 3 plus years postdoctoral or other relevant experience. Although an advanced degree in biology is not absolutely required, extensive experience working in a biological framework is necessary. Strong written and oral communication skills are necessary. The applicant must have a clear record of both initiative and collaborative skills. Also required are extensive bioinformatics and programming skills, particularly in the areas of Perl, Unix Linux, relational databases, gene and sequence analysis, RNA profiling analysis and related disciplines, statistics and application to design of experiments and analysis. Particular experience in the areas of metabolic and cardiovascular disease drug discovery is a definite plus. A record of scientific rigor and innovation in the areas of RNA, Protein, and Metabolite profiling as well as pathway and network analysis is desirable.

LOCALE: Princeton, NJ

HOW TO APPLY:
To formally apply for this position, please go online to http://www.bms.com/careers. You may search for the position above by requisition number from the detailed search page.

REFERENCE: Please apply to requisition #27734.

BIOINFORMATICIAN, IT Systems Manager

2009-04-22T12:25:00.002+05:30

BACKGROUND:

The postholder will act as the Bioinformatician – IT Systems Manager for the Inflammatory Arthritis Centre, Musculoskeletal Clinical Academic Unit, Barts and the London NHS Trust and will contribute to the overall scientific endeavour of the Centre for Experimental Medicine & Rheumatology within William Harvey Research Institute in order to increase the quality and standing of research of the Institution as a whole. The candidate will be primarily based at the Inflammatory Arthritis Centre in Mile End, but there may be occasional need to visit other sites across the campus in the course of the work.

RESPONSIBILITIES:
The successful candidate will be expected to design genotypic and phenotypic databases and address bioinformatics and statistical needs related to the design and analysis of genome wide studies. The successful candidate will additionally contribute to the wider development and extension of bioinformatics software tools within the institute.

REQUIREMENTS:

Applicants should have a degree in Bioinformatics/Computational Biology (or related degree with experience). In addition the applicant should have a solid understanding of the analysis of high throughput technologies, a comprehensive working knowledge of common bioinformatics tools and relevant statistical algorithms, and demonstrate the ability to apply that knowledge to help unravel the molecular basis of a disease.

It is also essential that the candidate has clear communication skills, with the ability to present methodologies and results succinctly and to provide advice, training and support for researchers.

PREFERENCES:
Experience of languages such as perl, php, R is essential and additional languages, e.g. Java or C, would be desirable. Familiarity with Linux network/server administration and web application development technologies will be an essential, as is proficiency in the use of relational databases, in particular MySQL. Experience in molecular biology and genetics research is desirable.

TERMS: 5 year fixed term contract

LOCALE:
Queen Mary University of London, Mile End and Charterhouse Square campuses

SALARY AND BENEFITS:
Professional Grade 5, 33,392 - 36,330 GBP per annum
- 30 days leave plus 4 College closure days
- Childcare vouchers scheme
- Contributory final salary pension scheme
- Interest free season ticket loan

HOW TO APPLY:
For an application form and further information, please visit the Human Resources website onhttp://www.hr.qmul.ac.uk/vacancies, or request details (quoting reference number: 09142/JO) via email csq-recruit@qmul.ac.uk. Applicants wishing to make a non-electronic application may contact our 24 hour recruitment line on 020-7882 6149 for details.

DEADLINE:

The deadline for return of completed applications is 12 noon (BST) on 29th April 2009. Applications (quoting the above reference number) should be returned via email to csq-recruit@qmul.ac.uk.

BIOINFORMATICS Scientist @ Whitehead Institute for Biomedical Research

2009-04-22T12:24:00.000+05:30

BACKGROUND:

The Bioinformatics and Research Computing Department supports and collaborates with Whitehead scientists working in the nearly twenty research laboratories. We are looking for a bioinformatics scientist with expertise in such areas as genomics, proteomics, sequence analysis, gene expression, high-throughput analyses, and image analysis to collaborate with our scientists and build tools. This position provides an opportunity to work on many different scientific and computational projects with Institute researchers. In addition, the person is expected to prepare and present Bioinformatics talks for Whitehead scientists.

RESPONSIBILITIES:

- Collaborate with and support Whitehead scientists and build tools in the areas of sequence, microarray and structural analysis, genomics, gene expression, high-throughput analyses, and image analysis.

- Assist with the design and development of bioinformatics-related programming projects.
- Identify or develop software and tools to analyze and manage biological data.
- Instruct scientists in the use of the best and latest bioinformatics tools available.
- Prepare and teach classes, courses and/or demonstrations on the use of various techniques and software tools.

REQUIREMENTS:
- Ph.D. in biology or related discipline required.
- A minimum of two years of bioinformatics/computational biology experience or the equivalent.
- Excellent interpersonal, verbal and written communication skills.
- Must be flexible and demonstrate good skills in instruction and training.
- Background in programming (eg. Perl, BioPerl, Java, R, MySQL) in a UNIX environment.
- Must be able to work well independently and with all levels of Institute researchers.

LOCALE: Cambridge, MA

WEB SITE: http://www.wi.mit.edu/

HOW TO APPLY:
Email resume to resumes@wi.mit.edu or send by fax to 617-258-5121.

Reasearch Leader, BIOINFORMATICS for Systems Biology

2009-04-15T10:32:00.000+05:30

BACKGROUND:

This is a corporate venture of the highest priority and financial backing. Our client is a globally recognized life sciences company and is committed to developing this break-through, Drug Discovery platform.

RESPONSIBILITIES:

Serving as the lead informatics officer, the incumbent will directly contribute to the research and development of a *paradigm shifting* Drug Discovery Engine.

Day to day responsibilities will include:

- Buiilding the appropriate informatics capabilities in coordination with Systems Biology leadership.

- Develop and coordinate the data package containing the appropriate reporting and analysis for pharmacological profiling of customers’ compounds

- Hire and manage 1-3 member team with bioinformatics expertise

REQUIREMENTS:
Qualifications (please, qualified applicants only):

- Ph. D. in Mathematics/Computer Science/Bioengineering/Molecular Biology/Chemistry/Physics, etc.

- Strong track record (10+ years ideally) with a hands-on background in bioinformatics for systems biology and/or biological network modeling

- Strong familiarity and expertise with existing/commercially available bioinformatics software

- Strong familiarity with cell/molecular biology and signal transduction pathways

- Proven ability to work with experimental scientists to develop appropriate results driven models

SALARY & BENEFITS:

Total compensation (base and bonus) for qualified candidates will be in the $180K ++ range annually. This position will include full corporate relocation, world-class benefits, and the opportunity to work in a dynamic and innovative company culture.

LOCALE:

**Please read before applying: The incumbent must be open to relocation to New York State for a 12-24 month period during the product research and development phase (at corporate HQ) and then be available to move to one of the company's divisions near a major life-sciences industry hub thereafter.

HOW TO APPLY:

Please email CV/Resume, along with brief cover letter to JCompton@agilesearchinc.com. I will follow up personally with all qualified applicants.

Natural Language Processing Analyst @ Marine Biological Laboratory

2009-04-15T10:27:00.000+05:30

The MBLWHOI Library at the Marine Biological Laboratory seeks applications for highly motivated informatics specialists to join a growing team of developers and informaticians focusing on the biology of aging. Join a community of researchers that are internationally recognized as defining the current trends and practices in marine information sciences and biological informatics.

RESPONSIBILITIES:

Develop Natural Language Processing (NLP) tools and RESTFUL web services Architect applications and web services using Java, Ruby, Rails Architect and develop data pipelines to integrate information from a range of data sources including, but not limited to: genomics, phenomics, biodiversity, demography, consumer health, and clinical research databases.

Collaborate with the biodiversity informatics group of the Encyclopedia of Life initiative, which is also located at the Marine Biological Laboratory.

Report to the Project Director for the Ellison Medical Foundation (EMF) funded initiative at the Marine Biological Laboratory to study the biology of aging across the spectrum of life.

REQUIREMENTS:
Education/Experience:
Required:

- Masters degree in Bioinformatics or comparable experience
- Formal training in biological science (e.g., molecular biology, biochemistry, biophysics)
- Demonstrable experience with database management systems (such as MySQL or PostgreSQL) and programming (e.g., Perl, PHP, Ruby, C/C++, and Java)
- Understanding of Semantic Web concepts, such as: RDF, OWL, Inference Engines, URIs
- Significant Experience implementing efficient algorithms in areas such as:
- Search engine query processing and/or index construction
- Inference algorithms, Logic Algorithms
- Machine Learning / Statistical Methods
- Graph Theory Algorithms
- Natural Language Processing algorithms, such as Entity Extraction
Preferred:
- Experience developing in a Mac OS X or Linux environment
- Experience in open source technologies is required and individuals who have participated in or contributed to the development of open source projects will be given higher consideration

TERMS: Full Time

LOCALE: Woods Hole, MA

HOW TO APPLY:
http://mbl.simplehire.com/applicants/Central?quickFind=50669

The MBL is an Equal Opportunity/Affirmative Action Employer.

PhD positions in Population Genetics

2009-04-15T10:25:00.002+05:30

BACKGROUND:

Several PhD positions are available in the Institute of Population Genetics at the Veterinary Medical University in Vienna from autumn 2009. Through the analysis of natural variation the students will receive training in evolutionary theory and population genetics in an interdisciplinary research environment. Students will join a lively institute working at the interface between experimental and theoretical population genetics. Our institute represents a synthesis of theoretical and experimental expertise in population genetics (Christian Schlötterer), molecular evolution and bioinformatics (Carolin Kosiol), functional genetics (Alistair McGregor and Thomas Flatt) and conservation genetics (Franz Suchentrunk). We welcome applications from international students as the working language of the institute is English.

PROJECTS:

- Functional characterization of copy number variation in Drosophila (Schlötterer group)
- Probabilistic modeling of inter- and intraspecies sequence evolution (Kosiol group)
- Mechanisms and evolution of Drosophila life history and aging (Flatt group)
- Genetic basis of morphological variation in Drosophila (McGregor group)
- Measuring gene flow between hare species by massive parallel sequencing (Suchentrunk group)

HOW TO APPLY:
See the following websites for more information on the projects and the application procedure: http://i122server.vu-wien.ac.at/pop/index.html

Post-doctoral position in BIOINFORMATICS @ CIC bioGUNE--Bilbao, Spain

2009-04-15T10:24:00.000+05:30

BACKGROUND:

A post-doctoral position is available at the Platform of Genome Analysis of the Functional Genomics Unit of CIC bioGUNE. The research lines in the laboratory involve the set up and development of tools for “Next-generation sequencing data analysis (mRNA, microRNAs, gDNA resequencing and gDNA de novo sequencing)”.

RESPONSIBILITIES:

Development of tools for "Next-generation sequencing data analysis"

REQUIREMENTS:

The applicant should have a PhD degree in one of the following areas: bioinformatics, computer science, statistics, biotechnology, or biology. Knowledge of programming and genomics is required; experience in web application development, relational databases, and large scale biological data management would be an advantage. Working knowledge of English is essential.

TERMS:

The position is for three years and provides a salary of 27,326 € per year.

LOCALE: Bilbao, Spain

SALARY AND BENEFITS: 27,326 EUR

HOW TO APPLY:

Applicants should submit a full CV and two reference letters by e-mail to Dr Ana M. Aransay, with ref. 2153 in the subject line, to rrhh@cicbiogune.es

DEADLINE: 30th May 2009

Next Generation Sequencing Analyst--Ann Arbor,

2009-03-26T23:04:00.003+05:30

BACKGROUND:

Local Ann Arbor Computational Biology Company is seeking a highly qualified individual to lead the company’s move into the Next Generation Sequencing market for data analysis. The qualified individual will routinely use the company’s hardware/software to provide proof-of-concept data analyses for prospective customers, publish the results of these proof-of-concept studies collaboratively whenever possible, provide overview and technical presentations detailing the company’s background and capabilities, and in general be in touch with the existing and emerging thought leaders in this exciting new genomics market. With responsibility for North America and a parent company located in Munich, Germany, frequent travel will be required

REQUIREMENTS:

The following qualifications are highly desirable:

- MS/PhD in molecular biology/genomics or equivalent scientific discipline
- Be familiar with high throughput genomic methods
- Ideally have experience with next generation sequencing
- Publications, including publications using Next Generation Sequencing data/applications
- A knowledge of the thought leaders and leading researchers in the field of DNA sequencing, especially Next Generation Sequencing
- Excellent computer skills
- Excellent people skills
- Excellent presentation skills

LOCALE: Michigan

HOW TO APPLY:

Call Russ Dotson at 248 205 2510 or email at rdotson@trialon.com

DEADLINE: N/A

BIOINFORMATICS Scientist @ Proteostasis Therapeutics

2009-03-26T22:57:00.002+05:30

BACKGROUND:

Proteostasis Therapeutics, Inc. is seeking highly motivated individuals interested in applying computational and bioinformatic approaches to drug discovery.

RESPONSIBILITIES:

The research interest is focused on developing/applying innovative data analysis capabilities to gain insights into gene networks involved in proteome homeostasis and protein mis-folding and investigate their disease relevance. High-throughput biological datasets such as microarray data, protein-protein interaction data, RNAi data will be explored and integrated. This scientist will be part of a bioinformatics team working closely with cross-discipline teams including biology and medicinal chemistry.

REQUIREMENTS:

Recent Ph.D. in bioinformatics, computational biology, or computer science/electrical engineering with exposure to life sciences. A strong publication record is essential.

- Proficiency in large-scale biological, “-omics” data analysis. Broad experience with microarray analysis required
- Working knowledge of systems biology (pathways, networks, etc) and sequence analysis
- Knowledge and experience in machine learning and data mining is preferred
- Proficiency in R, matlab, or equivalent statistical software
- Strong background in statistical analysis
- Good programming skills in Java, Perl, Python or C, can independently manipulate large datasets
- Familiarity with relational databases (SQL)
- Good understanding of data analysis methods and experimental design
- Highly analytical with good technical and problem solving skills
- Excellent written and verbal communication skills

PREFERENCES:

Postdoctoral experience or biotech/pharmaceutical industry experience is a plus.

LOCALE: Cambridge, MA

HOW TO APPLY:
Please send resume and cover letter to: info@proteostasis.com; include job code HG-BS in subject line.

Pre/post-doctoral research fellowship,

2009-03-26T22:51:00.007+05:30

RESPONSIBILITIES:

We are looking for a highly motivated young scientist or post-graduate student with a strong interest in data analysis. The new junior group-member will be immersed in a truly interdisciplinary project from day one, studying non-genetic sources of individuality (Why are identical twins different? Why do some respond to treatment, others not?).

REQUIREMENTS:

Successful candidates are expected to have a university degree in a technical or scientific discipline. Research in this field requires good statistical and software engineering skills. Candidates must hence be able to demonstrate previous coding experience (e.g., R, MatLab, C/C++, Java, Perl, Bash, ...). Knowledge of probabilistic modelling is a plus. Experience with bioinformatics data analysis is an advantage. The interdisciplinary nature of the group's work (http://www.biotec.boku.ac.at/7033.html?L=1) means that good communication skills in English are essential (working knowledge of German a plus). A strong interest in collaboration with experimental scientists is essential, and own experience in a laboratory a plus.

TERMS:

The position is available immediately and has an initial tenure of two years, with extensions possible. It is possible to pursue a PhD through this research fellowship.

SALARY:
Remuneration is internationally competitive and follows the national standard scale for researchers.

HOW TO APPLY:

Applications should be addressed to David Kreil (http://www.biotec.boku.ac.at/bimems.html?L=1#c13965). Please include a cover letter, a curriculum vitae, a list of previous research and publications. Two reference letters should be sent to us directly. We look forward to receiving your application by 15 March 2009. Late applications may be considered until the position has been filled. Please feel free to contact us (http://www.biotec.boku.ac.at/bicontact.html?L=1) if you have any questions.

Pre/post-doctoral research fellowship,

2009-03-26T22:51:00.005+05:30

RESPONSIBILITIES:

REQUIREMENTS:

TERMS:

The position is available immediately and has an initial tenure of two years, with extensions possible. It is possible to pursue a PhD through this research fellowship.

SALARY:
Remuneration is internationally competitive and follows the national standard scale for researchers.

HOW TO APPLY:

Pre/post-doctoral research fellowship,

2009-03-26T22:51:00.003+05:30

RESPONSIBILITIES:

REQUIREMENTS:

TERMS:

The position is available immediately and has an initial tenure of two years, with extensions possible. It is possible to pursue a PhD through this research fellowship.

SALARY:
Remuneration is internationally competitive and follows the national standard scale for researchers.

HOW TO APPLY:

Pre/post-doctoral research fellowship,

2009-03-26T22:51:00.001+05:30

RESPONSIBILITIES:

REQUIREMENTS:

TERMS:

The position is available immediately and has an initial tenure of two years, with extensions possible. It is possible to pursue a PhD through this research fellowship.

SALARY:
Remuneration is internationally competitive and follows the national standard scale for researchers.

HOW TO APPLY:

BIOINFORMATICS Knowledgebase & Cyberinfrastructure Consultant

2009-03-26T22:48:00.000+05:30

RESPONSIBILITIES:

The Great Lakes Bioenergy Research Center (GLBRC; www.greatlakesbioenergy.org) has an immediate opening for a full-time consultant with expertise in bioinformatics and computational biology to act as program leader on a multi-million dollar Dept. of Energy (DOE) collaborative project to build a Systems Biology Knowledgebase (http://genomicsgtl.energy.gov/compbio/index.shtml). The goal of the two-year project is to develop an informatics resource that will support both systems biology research and DOE science-application areas, particularly biofuel development, carbon sequestration, and environmental sustainability.

REQUIREMENTS:

The successful candidate must be able to start immediately as a consultant. This individual must be action-oriented, have expertise in cutting-edge computational biology and bioinformatics, be conversant in the current problems of systems biology, and be highly motivated to contribute to new breakthroughs in biological computation and graphical display of complex information. This is a exceptional opportunity for the right individual to help determine how next-generation computational methods are deployed to meet the national challenge of sustainable energy independence.

HOW TO APPLY:

Interested applicants should reply to kbase@glbrc.wisc.edu with a cover letter, cv, and contact information for three references.

Postdoc: Evolution of Gene expression

2009-02-10T00:22:00.008+05:30

BACKGROUND:

The recent technological breakthrough of massively parallel sequencing has the potential to replace currently existing methods for expression profiling. In addition to intraspecific transcriptome analyses, this method also allows the comparison of gene expression between species.

RESPONSIBILITIES:

The successful candidate will serve a central role in bridging the gap between experimentalists generating expression data and functional biologists performing tests on interesting obtained from the expression analyses.

REQUIREMENTS:

We are searching for an individual with strong bioinformatic sills, a solid background in biology, and excellent communication aptitude.

LOCALE:

The post is based at the Institute of Population Genetics at the VUW, Vienna. The Vienna Research Area has a strong network of research groups interested in population genetics, statistical genetics and bioinformatics providing an excellent scientific environment (e.g. N. Barton, R. Bürger, U. Diekmann A. Futschik, A. v. Haeseler, J. Hermisson, I. Hofacker, C. Kosiol, P. Schuster, K. Sigmund, C. Vogl).

HOW TO APPLY:

Applications should be sent to C. Schlötterer (christian.schloetterer@vu-wien.ac.at), including the names and emails of two academic references and a brief description of the research interests.

DEADLINE:

The position is immediately available and the search continues until the position is filled.

Senior Programmer Analyst

2009-02-10T00:15:00.008+05:30

RESPONSIBILITIES:

An opening is available immediately for a bioinformatics researcher in a large and dynamic laboratory performing innovative research in virus detection and discovery at Columbia University. The candidate will be expected to contribute to multiple projects employing an interdisciplinary team of scientists and researchers. Shared responsibilities include administration of the Linux servers, developing sequence assembly and analysis methods for high-throughput pyro-sequencing data, maintaining data analysis pipelines for high density viral microarrays, a data sharing web portal, and maintenance of research databases containing diverse experimental data.

REQUIREMENTS:

Applicants must have a good working knowledge of Perl/BioPerl and MySQL (experience in Linux administration and web development is strongly desirable.)

This position is strongly interdisciplinary and requires a bachelor’s degree in a biological science/bioinformatics/computer science and at least two years experience in a computer support role (a master’s degree in bioinformatics is strongly preferred).

Good communication skills are a must. The applicant will contribute to publications and research grants and communicate clearly with researchers. This position requires excellent organizational skills and the ability to develop relationships with collaborators to execute projects.

Minimum Qualifications for Grade:

Requires a bachelor’s degree in a biological science and two years experience in a computer support role.

Additional Position-Specific Minimum Qualifications:

The candidate must have a good working knowledge of the Linux operating system, Perl/BioPerl and MySQL. Excellent organizational and communication skills are a must.

Experience with sequence assembly and analysis, molecular phylogeny, primer and array design, and single-color microarray analysis will be considered especially favorable. Familiarity with statistical packages (e.g., SPSS, SAS, R) and web server development is also a plus.

HOW TO APPLY:
Applicants should apply via the Columbia University HR website https://jobs.columbia.edu/applicants/Central?quickFind=113616

Microarray & High-throughput Sequence Curator

2009-02-10T00:11:00.009+05:30

BACKGROUND:

Computercraft seeks a highly motivated Molecular Biologist/Biochemist to join the Gene Expression Omnibus (GEO) team onsite at the National Institutes of Health (NIH) in Bethesda, MD. The Gene Expression Omnibus (GEO) is the largest fully public repository for functional genomic data, primarily microarray and high-throughput sequence datasets. More information on the Gene Expression Omnibus can be found on the web site http://www.ncbi.nlm.nih.gov/geo.

We are currently looking for a molecular biologist/biochemist to help review and process incoming data submissions, and perform advanced curation of data into comparable datasets. The successful candidate will work at NIH's National Center for Biotechnology Information (NCBI) in the National Library of Medicine (NLM).

RESPONSIBILITIES:
The successful candidate will perform the following tasks:

Review and evaluate data submissions for structural integrity and content
Communicate extensively with researchers, resolving issues relating to submission procedures, formats, content, and site navigation
Assemble, process, and deposit large data files
Perform advanced database curation and assembly of comparable datasets to reflect biological variables and experimental design
Test, develop, and troubleshoot new query, data display, and analysis features

REQUIREMENTS:

This challenging position requires a Ph.D. or M.Sc in molecular biology or related field. Practical experience with microarrays or high-throughput sequencing is highly desirable but not required to apply. Excellent general computer skills and organizational skills are required for this detail-oriented position. Excellent written/verbal communication skills are an absolute requirement.

SALARY BENEFITS:

Computercraft offers a competitive salary and an excellent benefits package including PPO health insurance with 100% company paid premiums, 401K program with matching, paid time off and holiday pay, life insurance, flexible spending and disability coverage. We offer an excellent work life balance with a standard 40 hour work week and the chance to work alongside accomplished scientists at NIH/NCBI.

HOW TO APPLY:

To apply for this position or learn about other Computercraft job opportunities, please visit the Careers section of our website: http://www.computercraft-usa.com/

Tissue Bank Program Manager @ Booz Allen Hamilton--Rockville, MD

2009-01-19T10:58:00.001+05:30

RESPONSIBILITIES:
Key Role: Provide expert technical, scientific and strategic consulting to our government clients within the bioinformatics arena. Develop or manage the development of biomedical information systems. Work with clients gathering technical specifications and requirements and delivering and deploying solutions.

REQUIREMENTS:
5+ years of experience with developing or managing the development of biomedical informatics systems, including working with the scientific community in the collection of requirements, software design, development and deployment. Experience with software engineering methodologies, including those derived from the Unified Process Framework. Experience with managing groups carrying out biomedical informatics activities, including software and scientific staff required. Ph.D. degree in Biology, CS, or Software Engineering.

ADDITIONAL:
Ability to develop refined written materials and presentations. Possession of excellent oral communication skills.

LOCALE: Rockville, MD

HOW TO APPLY:
Send resume to:
Sharon Carroll
Booz Allen Hamilton
carroll_sharon@ne.bah.com
www.bah.com
650-637-1505

ABOUT US:
Integrating the full range of consulting capabilities, Booz Allen is the one firm that helps clients solve their toughest problems, working by their side to help them achieve their missions. Booz Allen is committed to delivering results that endure.

Molecular Modeller @ Oxford Nanopore--Kidlington, UK

2009-01-19T10:56:00.000+05:30

RESPONSIBILITIES:
A high-calibre molecular modeller is sought to work with our informatics and nanopore chemistry teams. The candidate will be responsible for furnishing molecular modeling results and hypotheses to co-workers who are developing a nanopore-exonuclease construct (The ‘Exopore’ group). The candidate should be able to communicate complex molecular information in a clear and articulate manner.

The role will involve the use of molecular dynamics simulations, free energy calculations, QM and QM/MM calculations on biological systems, familiarity with Linux HPC clusters and some programming skills.

HOW TO APPLY:
Apply at www.nanoporetech.com/vacanies or email careers@nanoporetech.com with a CV and covering letter.

Scientific Data Analyst @ Oxford Nanopore--Kidlington, UK

2009-01-19T10:55:00.000+05:30

RESPONSIBILITIES:
We are recruiting a Data Analyst to join our rapidly expanding informatics team, to participate in the development of our revolutionary DNA sequencing system. This role will involve analysis and interpretation of data sets derived during the development and optimisation of our DNA sequencing platform (and its derivatives).

REQUIREMENTS:
The candidate should be a highly numerate individual, with the ability to manage large data sets, apply a wide range of appropriate analyses, develop ad-hoc software tools and most importantly, the ability to communicate complex numerical and statistical issues across all functional domains within the entire development project.

Successful candidates will be qualified to postdoctoral level in a numerate discipline such as statistics, applied mathematics or physics. He/she will have a proven track record of supporting complex multi-disciplinary development projects within an industrial setting. Preference will be given to experience of product development or process development. Technical leadership skills, as well as proven team working, will also be valued.

HOW TO APPLY:
Apply at www.nanoporetech.com/vacanies or email careers@nanoporetech.com with a CV and covering letter.

COMPUTATIONAL BIOLOGISTS & INFORMATICIANS (Various) @ Oxford Nanopore--Kidlington

2009-01-19T10:53:00.000+05:30

BACKGROUND:
We are seeking Computational Biologists and Bioinformaticians to join our rapidly growing informatics team. Oxford Nanopore is developing a new generation of DNA sequencing technology and requires team members to participate in the evaluation and development of this platform. In a competitive environment, we seek candidates who respond well to aggressive deadlines and a dynamic working environment.

Opportunities also exist to develop new sequencing applications and also any appropriate analysis tools and algorithms. We already have a number of active collaborations with leaders in the fields of genetics and genomics and our bioinformatics capability would be at the forefront of these activities.

RESPONSIBILITIES:
We invite submissions for roles as programmers, software engineers, scientific data analysts and bioinformaticians. Ideal candidates will encompass areas including: R&D data analysis support, instrument system development, data management and exploitation of sequence data in the context of the latest scientific applications.

REQUIREMENTS:
Successful applicants will be qualified to at least postgraduate level in a highly numerate discipline. Positions will vary according to experience and background. Preference is given to applicants with a track record of project delivery in industrial environments and a demonstrable ability to work to timelines and milestones.

Technical skills may include, but not be limited to:
- Programming in Perl, Python, C/C++.
- Knowledge of UNIX/Windows - strong skills in UNIX.
- High degree of numeracy and knowledge of core algorithms and analysis techniques ranging from DNA sequencing to quantitative tag based counting applications (e.g. Gene expression).
- R, Matlab, Pipeline Pilot.
- Methods in next-generation DNA sequencing, including whole-genome analyses and annotation.
- High throughput analysis pipelines and workflows.

HOW TO APPLY:
Apply at www.nanoporetech.com/vacanies or email careers@nanoporetech.com with a CV and covering letter.

Instrument Software Team Leader @ Oxford Nanopore--Kidlington, UK

2009-01-19T10:51:00.000+05:30

RESPONSIBILITIES:
We are seeking a highly motivated and dynamic individual to join our rapidly growing informatics team, to lead the development of the the software and computing subsystem of our revolutionary DNA sequencer. DNA sequencing is a highly competitive scientific and commercial environment. The candidate will be required to work to aggressive timelines within an agile development process.

REQUIREMENTS:
Successful candidates will have a background in developing embedded computing solutions for high-end DSP or related HPC devices. This includes instrument control and the evaluation and architecting of hardware/software and any relevant interfaces. The role requires close collaboration with hardware engineers on the total design and implementation of the sensor system(s).

We are looking for an individual who has led small teams of programmers on successful projects demanding data processing and real-time control devices or systems. Candidates will be experienced in leading projects including:

- Agile software development practices and a thorough knowledge of software design patterns and development methodologies
- Programming in C/C++ (and derivatives), Perl, Python, VHDL, Erlang
- Algorithm design and efficient implementation
- Embedded systems development
- Numerical methods and signal processing techniques
- MatLab, R and LabView

Candidates with a background in developing high performance sensing devices for biological applications (such as DNA sequencing, Mass Spectrometry etc) will be considered favourably.

HOW TO APPLY:
Apply at www.nanoporetech.com/vacanies or email careers@nanoporetech.com with a CV and covering letter.

BIOINFORMATICIAN @ EMBL-EBI--Hinxton/Cambridge, UK

2008-12-23T21:31:00.000+05:30

BACKGROUND:

The European Bioinformatics Institute provides cutting edge research and services for biomolecular data. We are seeking a highly motivated Bioinformatician to work in the Proteomics Services Team on the Reactome pathways knowledgebase, a high quality resource at the heart of molecular biology research. The post involves further development of the open source Reactome source code as well as data management in an internationally distributed team.

REQUIREMENTS:

Applicants should have a degree in a relevant field (ideally an interdisciplinary degree in biology/chemistry/computer science) or proven professional experience. Profound knowledge of Java and/or Perl is required. Experience in relational databases, and ideally web application development is highly desireable.

The post holder must be able to work independently and interact well within a team environment. Good communication and interpersonal skills as well as a working knowledge of English are essential.

TERMS:

An initial contract of 3 years will be offered to the successful candidate. This can be renewed, depending on circumstances at the time of review.

HOW TO APPLY:
For further information please visit http://www.embl.org/, http://www.ebi.ac.uk/, http://www.reactome.org/

EMBL is an inclusive, equal opportunity employer offering attractive conditions and benefits appropriate to an international research organisation.

To apply, please email a cover letter, CV (in English) and contact information of three professional references quoting ref. no. BIO/08/086/EBI in the subject line, to: applications@ebi.ac.uk.

Senior Scientist, COMPUTATIONAL BIOLOGY

2008-12-23T21:29:00.000+05:30

BACKGROUND:

GrassRoots Biotechnology is a new agricultural biotechnology company located in the RTP area of North Carolina. We will utilize a Systems Biology Approach to develop new traits for the biofuel, food and industrial markets. The company, formed in 2007, intends to commercialize innovations and expertise developed by Dr. Philip Benfey at Duke University. Dr. Benfey is one of the world leaders in the fields of plant cell development and genomics.

RESPONSIBILITIES:

GrassRoots seeks a highly motivated and qualified scientist to lead research efforts in the development and implementation of novel algorithms and tools to accelerate discovery and delivery of high value agronomic traits. The successful candidate will be responsible for the design and implementation of novel analysis tools leveraging our rapidly expanding resource of cell- and tissue-specific microarray expression data. He or she will also interface closely with other team members from various biological disciplines to validate algorithm predictions and to support their research objectives.

REQUIREMENTS:
Education and skills:

- Ph.D. (preferred) or M.S. (with equivalent work experience) in Bioinformatics, Computational Biology, Computer Science, or related computational discipline;
- Initiative in developing new technologies and approaches;
- Ability to work independently, be detail-oriented and have excellent analytical skills;
- Outstanding communication and interpersonal skills.

Documented expertise in the following areas required

- Programming: Java, C/C++, Perl, or Python;
- Relational database and SQL experience: MySQL or PostGres;
- Microarray expression analysis
- Sequence analysis and database searches;
- Matlab or R programming

Preference will be given to local candidates, but outstanding candidates will always be considered

TERMS: Full Time

LOCALE: RTP, North Carolina

SALARY AND BENEFITS:

Competitive starting salary, equity and benefits.

HOW TO APPLY:
Please send (1) curriculum vitae, (2) statement of research interests, (3) and the names of at least three references to tedd.elich@grassrootsbio.com

BIOINFORMATICIAN @ Children’s Hospital Boston--Boston, MA (US)

2008-12-23T21:27:00.000+05:30

RESPONSIBILITIES:

The Genomics and Informatics Programs at the Children’s Hospital Boston and Harvard Medical School is seeking a Bioinformatician for an NIH funded Program Project grant to study the pathogenesis and possible treatments for the muscular dystrophies.

The successful candidate will be expected to understand basic biological problems, to formulate these problems mathematically, and model them using existing and novel computational/bioinformatics methods to support the various scientific goals of the program's investigators. The candidate will have mastered fundamental concepts and methods in these analytic areas: gene expression; comparative, integrative and sequential genomics; and biomolecular interactions, networks and ontologies. The candidate will contribute/maintain software development and computational infrastructure standards for the program. The exceptional candidate will be able to independently develop novel computational methods to address the program's basic biological questions.

REQUIREMENTS:

This position requires an advanced degree in biomedical engineering, computer science, computational/mathematical biology or related discipline or at t least 2 years job experience working in bioinformatics; excellent communication skills and the ability to work as part of a team.

HOW TO APPLY:

Interested candidates should send a cover letter and resume to Marcy Belliveau by email to: marcy.belliveau@childrens.harvard.edu or mail to: Program in Genomics, Enders 561, Children's Hospital Boston, 300 Longwood Ave., Boston, MA 02115.

BIOINFORMATICIAN/BIOSTATISTICIAN @ Allegro Diagnostics--Boston

2008-11-17T13:09:00.000+05:30

BACKGROUND:

Allegro Diagnostics, Inc. is a molecular diagnostics company using proprietary technology and bioinformatics to diagnose diseases of epithelial origin, such as lung cancer. We are seeking a bioinformatics specialist.

RESPONSIBILITIES:

Allegro Diagnostics, Inc. seeks a Biostatistician / Bioinformatics Specialist to assist with analysis of data from a clinical trial to test the efficacy of a gene-expression based diagnostic product, using Affymetrix GeneChip technology, and to assist with the analysis of genome-wide gene expression data to support further product development.

Characteristic duties include:
- Develop and implement existing and new computational methods and tools for high-throughput analysis of microarray data.
- Assist with the design and development of major bioinformatics-related programming projects.
- Collaborate on short and long term bioinformatics projects with researchers in the lab and support lab personnel in the area of bioinformatics analysis.

REQUIREMENTS:
Education: MA or MS in biology, bioinformatics, biostatistics or another quantitative discipline

Experience: Qualified candidates will:
- Be quantitatively inclined
- Have demonstratable experience with statistical data analysis, including the analysis of genome-wide gene-expression data and microarray data analysis,
- Be comfortable working both independently and as part of a team
- Have excellent organizational skills.
- Have experience with computer programming and/or databases
- Proven experience using bioinformatics to solve genomically important questions.
- Experience with microarray data analysis, familiarity with online bioinformatics tools and databases, and pathway analysis.

LOCALE: Boston, MA

SALARY AND BENEFITS:
Per hour rate based on experience

HOW TO APPLY:
Please send your resume and letter of interest to: Kate Porta kporta@allegrodx.com

DEADLINE:
We are looking to fill the position as soon as possible.

Senior Machine Learning / BIOINFORMATICS / COMP. BIOLOGY Scientist @ Aureon Laboratories--Yonkers, NY (US)

2008-11-17T13:07:00.000+05:30

BACKGROUND:

Position: Senior Machine Learning Scientist / Bioinformatics Scientist/ Computational Biology Scientist

About the company: Aureon Laboratories applies “Systems Pathology” to develop predictive clinical tests for cancer care as well as to facilitate bio-pharmaceutical research and development. Aureon's personalized predictive pathology technology has the potential to significantly advance the state of clinical medicine.

Allied with major cancer centers, Aureon is primarily focusing on oncology-based clinical tests to assist physicians in developing appropriate treatment strategies for staging patients with cancer. By employing proprietary tissue analysis technologies Aureon also supports bio-pharmaceutical companies in their quest to develop better targeted therapeutics.

Aureon was co-founded by leading physician-scientists at Memorial Sloan-Kettering Cancer Center, Yale Cancer Center, and Albert Einstein College of Medicine as well as investors from Sprout Group and Atlas Venture.

RESPONSIBILITIES:

Aureon’s Machine Learning Department receives data defining a patient’s disease profile from a variety of domains, including clinical information (i.e., race, age), bio-molecular marker expression, and image analysis of the patient’s tissue. The department interacts with doctors, biologists, and other mathematical/technical experts to analyze and integrate diverse information domains and build models of cancer growth.

Tasks include:
1) Developing novel algorithms and approaches and/or adapting/improving existing technologies for survival analysis and prognostic predictions
2) Developing feature selection procedures to distill through large datasets in order to identify crucial pieces of information, including gene expression and biomarker data
3) Addressing challenges of missing data and small cohorts that necessitate novel approaches
4) Analyzing and resolving institutional variances in datasets
5) Coordinating with renown worldwide research institutions to design studies and analyses

While commercially oriented, positions are research based, and individuals continue to publish papers, etc. Additionally, candidates will work in a small company environment and interact daily with doctors, image analysis experts, molecular scientists and others to solve challenges at the unique confluence of systems pathology where many diverse fields converge.

REQUIREMENTS:
Required Qualifications/Background:
- Extensive background in regression modeling, feature discovery/selection, optimization, dataset manipulation, exploratory data analysis.
- Experience with support vector machines
- Advanced degree in computer science/bioinformatics/related quantitative fields
- Significant industrial/research experience (at least 7 years post graduate degree)
- Excellent verbal and written communication skills with respect to technical and non-technical audiences
- Ability to positively interact and engage as a team member within a collaborative environment

PREFERENCES:
Additional Desired Characteristics:
- Experience in survival analysis, Cox proportional hazard modeling
- Familiarity with Matlab and/or SAS
- Experience in Software Engineering: design, documentation, etc.

LOCALE:
Yonkers, NY (Right outside NYC)

SALARY AND BENEFITS:
Compensation and benefits include: Competitive salary; stock options; 401(k); medical/dental/life insurance; flexible working hours and paid vacation.

HOW TO APPLY:
Email resume/CV to: recruiter@aureon.com

BIOINFORMATICIAN @ EMBL-EBI--Hinxton/Cambridge, UK

2008-11-17T13:03:00.000+05:30

BACKGROUND:

The EBI is a world-leading bioinformatics centre providing biological data to the scientific community, with expertise in data storage, analysis and representation. Ensembl is one of the world leaders in vertebrate genome annotation and one of the key services of the EBI. We are currently in the process of extending the use of Ensembl to cover a wider range of species (a project known as Ensembl Genomes); which will result in the launch of a number of new divisions e.g. Ensembl Plants, Ensembl Fungi, etc) over the course of the next six months.

RESPONSIBILITIES:

We are currently looking to recruit two additional bioinformaticians to join the Ensembl Genomes team to work on Ensembl Plants. The primary task of the postholders will be the integration and analysis of data within the Ensembl Plants database; and the exploitation and extension of existing Ensembl technologies to meet the specific challenges posed by plant genomes. These include the processing of large scale genome re-sequencing data; comparative genomics; standardisation of genome annotation and the correct representation of polyploidy genomes.

The postholders will be expected to interact with our collaborators within the plant research and bioinformatics communities in order to identify priorities and meet specific needs. The positions represent an exciting opportunity for programmers with an interest in plant genomes to help shape the development of the Ensembl Plants site.

REQUIREMENTS:

Applicants should possess a degree-level qualification in the computational or biological sciences and have at least two years experience of professional software development. Candidates must be highly proficient in the use of relational databases (particularly mysql) and be expert in the programming language Perl. Additional languages such as Java are desirable but not essential. Familiarity with the Ensembl system, genome annotation, or a track record in plant bioinformatics will be highly advantageous.

The incumbants should be self motivated and willing to accept responsibility. They will have excellent communication, interpersonal and advanced English language skills.

TERMS:
An initial contract of 2 years will be offered to the successful candidate. This can be renewed, depending on circumstances at the time of review.

HOW TO APPLY:
For further information please visit http://www.embl.org/ and http://www.ebi.ac.uk/

Manager of Statistics and BIOINFORMATICS

2008-11-05T10:14:00.000+05:30

BACKGROUND:

Asuragen formed from a key group of Ambion scientists and executives to focus efforts on cancer diagnostics. Members of our analytical team come from a variety of backgrounds and disciplines—including statistics, bioinformatics, machine learning, computational biology and research methodology. At Asuragen, you will have an opportunity to work with scientists from around the world on cutting edge diagnostic, prognostic and predictive research. The bioinformatics group plays a key role in all aspects of GLP and CLIA service launches, diagnostic kit development and regulatory submissions. As the Manager of Statistics and Bioinformatics, you will have the opportunity to direct team members and personally participate in all facets of molecular diagnostic bioinformatics.

RESPONSIBILITIES:

The Manager of Statistics and Bioinformatics will take a hands-on approach to lead and mentor a small, but growing group of multi-disciplinary bioinformaticians with backgrounds in statistics, computational biology, network biology and machine learning, supporting the Discovery, Diagnostic and Services divisions within Asuragen.

- Manage, mentor and provide vision in bioinformatics and statistics to the bioinformatics group.
- Collaborate and assist with biomarker discovery and validation efforts to facilitate the migration of diagnostic, prognostic and predictive projects from discovery to development and manufacturing as regulatory approved commercial products.
- Define and prepare study designs and/or research plans for collaborative and/or independent diagnostic and hypothesis testing projects.
- Review reports and ensure that activities and processes performed are conducted according to requirements using appropriate methods and software.
- Communicate clearly and authoritatively with customers in the area of molecular diagnostics.
- Support new Asuragen Service product launches with appropriate analytical methods.
- Work directly with Asuragen Services group on bioinformatic/data analysis project requests and deliverables.
- Provide input on new potential Bioinformatic Services that can be packaged and sold to clients.

REQUIREMENTS:

- PhD in Bioinformatics, Physics, Mathematics, Statistics, Computer Science or comparable technical and quantitative field.
- Minimum 3 years in medical/biotechnology industry and/or post-doctoral experience including significant experience with molecular biology
- Ability to define problems, design studies to resolve problems, and draw valid conclusions
- Ability to interpret results and analyses to ensure validity of conclusions
- Strong communication, writing and presentation skills

HOW TO APPLY:
Apply to careers@asuragen.com

Tunure-tract in biological science, BIOINFORMATICS expertise @ UOIT--Ontario, Canada

2008-11-05T10:13:00.000+05:30

BACKGROUND:

We invite you to consider joining UOIT’s globally trained faculty as we further our reputation as a leading-edge learning environment and delivering innovative research. UOIT has a 21st-century vision of teaching and learning excellence. Our educational philosophy is to challenge, encourage innovation, and connect our faculty, students and the community, while respecting the best practice traditions of Canada's established universities.

The Faculty of Science offers an Honours Bachelor of Science degree program in Biological Science, including specializations in Pharmaceutical Biotechnology, Environmental Toxicology and Life Sciences. The Faculty also offers Honours BSc programs in Applied and Industrial Mathematics, Chemistry, Computing Science, Forensic Science (with strong biology and chemistry content) and Physics, as well as Concurrent Education and Science programs in conjunction with UOIT’s Faculty of Education. MSc programs in Modelling and Computational Science, Applied Bioscience, and Materials Science commenced in 2007. A PhD proposal in Applied Bioscience has been submitted for approval, and is planned for September 2009 startup.

REQUIREMENTS:

The Faculty of Science invites applications for a tenure-stream or tenured position in Biological Science at any rank; effective July 1, 2009. This position is subject to budgetary approval. Applicants with research expertise in bioinformatics or in pharmacology are being sought, and should possess a PhD in biology or a related area, a strong academic background, and a record of excellence in research.

RESPONSIBILITIES:

The successful candidate will be expected to conduct active and innovative research and to teach at the undergraduate and postgraduate levels in UOIT’s biological science programs. In keeping with a technology-enhanced learning environment utilizing laptop computers and wireless connectivity, UOIT seeks faculty who strive to explore and develop new pedagogies.

HOW TO APPLY:

Applications will be accepted until December 15, 2008 or until a suitable candidate is found. Applicants should submit in electronic format, with their name and the above competition number in the subject line, a covering letter, a curriculum vitae including a list of publications, a statement of teaching interests, an outline of their present research program and a brief future research plan, and a list of at least 3 referees to careers@uoit.ca. Candidates for the position of full Professor are required to provide a list of four referees.

REFERENCE: Competition number UOIT08-99

UOIT is an equal opportunity employer and welcomes applications from qualified women and men, including members of visible minorities, Aboriginal peoples and persons with disabilities. All qualified candidates are encouraged to apply; however, Canadians and permanent residents will be given priority

Director of Bioinformatics

2008-11-05T10:09:00.000+05:30

Job Description:

Prediction Sciences is a product-stage company addressing the emerging opportunities in personalized medicine. Our strategic vision is to conceive, develop and commercialize

innovative diagnostic tests that predict outcome in oncology, neurology, and cardiology.

Our first product, Insight Dx™ Breast Cancer Profile, will be launched before the end of 2008, and it is to be followed by others in colorectal cancer and stroke. Prediction Sciences has extensive biomarker discovery efforts underway and has licensing and joint

collaboration projects in process with over 20 leading academic institutions on six continents. The company has spent the last year validating its business model with key stakeholders and is now positioned for rapid expansion and execution of its business plan.

Skills Required:
RESPONSIBILITIES:
The interdisciplinary nature of bioinformatics requires a solid foundation in
computational biology. The Director should have a Ph.D. in a computational science field
(e.g. Mathematics or Statistics), or a life science field (e.g. Molecular Biology or Cell

Biology) with extensive experience in bioinformatics and computational biology,

including a successful track record of management and development. Experience in the in

vitro diagnostic and/or drug development industry (biotech or pharmaceutical) is highly

preferred.
The Director of Bioinformatics will become an important member of the team at our
headquarters in La Jolla, California reporting to the CEO. Primary duties will include the
further development and implementation of existing proprietary diagnostic algorithms, as

well as the conception, design, and implementation of new algorithms.This involves nonlinear

predictive mathematical modeling of multivariate data sets, interaction with
biology, laboratory, and business personnel, and writing for internal use and publication.
The candidate will have the opportunity to create, in a short time, clinical tests that will
help save lives and alleviate future health problems in oncology, neurology, and
cardiology.
Specific Responsibilities:

- Non-linear predictive modeling; statistical pattern recognition
- Utilize understanding and experience in assessing data quality and data feature selection
for protein expression and DNA polymorphism data
- Apply machine learning techniques (e.g., kernel-based methods) to clinical data sets for
development of algorithms and use conventional biostatistics (e.g., Kaplan-Meier
survival analysis, Cox proportional hazards, etc.) to test performance
- Evaluate data collected as part of ongoing clinical trials as well as mining of data
submitted to and available from the FDA
- Interface with the FDA on relevant topics
- Create statistical text for study concept documents and protocols (study design,
endpoints, sample size/power study, methods for analysis)
- Develop and maintain standardized statistical approaches and methodology
- Utilize independent project management skills to ensure timely and reliable results
- Manage and direct the work of one or more institutions/consultants to achieve timely
project deliverables

Qualifications:
REQUIREMENTS:

- PhD in a computational science field (e.g. Mathematics or Statistics), or a life science
field (e.g. Molecular Biology or Cell Biology) with extensive experience in
bioinformatics/computational biology
- Minimum of 4 years experience in the field with a proven successful track record in
analysis and algorithm development on highly complex genomic/proteomic datasets—
both large and small
- Track record of managing 1 or more employees as well as a demonstrated record of
project management success
- Experience with statistical modeling including some or all of the following: linear and
non-linear predictive feature selection and algorithm development, parametric and nonparametric
techniques, statistical pattern recognition
- Experience with mathematical modeling and a variety of software packages
- Strong programming skills in MatLab, R and/or SAS, C/C++, Perl, mySQL, and PHP
– Experience with high-performance computing clusters
- Critical understanding of systems biology and marker data in disease (oncology
preferred), including pathway analysis using gene/protein expression and/or DNA variant
data.
- Experience and ability to manage outside consultants/academic institutions.

Job Category:    Bioinformatics
Job Status:    Full Time
Location:     La Jolla, California, United States
Start Date:     ASAP
Salary:     Undisclosed
Contact:     Cornelius Diamond
Email:    hr@predict.net

Computational Genomics and BIOINFORMATICS

2008-10-13T22:02:00.001+05:30

BACKGROUND:

Immediate opening for a Master’s level scientist with a degree in computer science or bioinformatics/computational biology (or equivalent experience) to help an innovative, interdisciplinary, hospital-based group of clinicians (MDs and MD-PhDs) and basic research scientists develop, test, document, and maintain novel computational genomics resources (applications and services) and infrastructure on-site and in the cloud for translational (i.e., from the laboratory to the clinic) infectious disease and human genetics research.

RESPONSIBILITIES:

See "Background" above. Responsibilities will also include systems administration of Linux (SLES and CentOS) and Windows (2008) servers running natively or under VMWare/Xen/Hyper-V virtualization either on-site or in the cloud on Amazon EC2. Looking forward, we eventually want to get out of the business of routine hardware maintenance and systems administration and contract these responsibilities out to cloud-based service providers. We especially seek to use the cloud, in conjunction with functionality-rich REST-interface-based wikis such as the MindTouch Deki Wiki, to expose large, complex datasets and offer compelling computational genomics services for research and education.

REQUIREMENTS:

See "Background" above. Key generic requirements are resourcefulness, learning agility, a strong sense of initiative, and excellent oral and written communication skills. Candidates with experience using—and coding functionality that interacts with—public nucleotide and protein sequence databases, sequence alignment software, and related computational genomic resources will be strongly preferred. For application and service-oriented programming we generally use C# or (increasingly) F# under the .Net Framework and Mono, as well as Perl. However, we welcome expertise in Python, Ruby, Java, C++/C, Matlab, and especially R. Experience working with PowerBuilder, Sybase RDBMS, and VBA would be a plus for helping maintain and refactor legacy code. Familiarity with relational database design and implementation, SQL programming, and client data access programming using RDBMS such as MySQL and SQL Server 2008 also highly desirable.

TERMS: Full-time.

LOCALE:

Pittsburgh is a friendly, affordable city to live in; has a pleasant climate; and has outstanding educational institutions, cultural amenities, and professional sports franchises.

SALARY AND BENEFITS:

Salary commensurate with experience, together with a competitive benefit package.

HOW TO APPLY:

Qualified applicants should send their CV and have three reference letters sent to Ms. Tawanda Littlejohn (preferably by e-mail at tlittlej@wpahs.org), Center for Genomic Sciences, Allegheny-Singer Research Institute, 320 East North Avenue, Pittsburgh, PA 15212. Applicants with less than two years of post-graduate experience should arrange to have their transcripts sent as well.

Postdoc for IEDB BIOINFORMATICS team

2008-10-13T22:00:00.000+05:30

BACKGROUND:

Founded in 1988, the La Jolla Institute for Allergy and Immunology (www.liai.org) is a non-profit medical research center dedicated to increasing knowledge and improving human health through studies of the immune system. Researchers at the institute carry out studies designed to understand and lead to the development of cures for cancer, allergy and asthma, infectious diseases, and autoimmune diseases such as diabetes, inflammatory bowel disease and arthritis. The institute's research staff includes over 100 Ph.Ds.

RESPONSIBILITIES:

We are looking for a talented and highly motivated postdoc to join the Immune Epitope Database and Analysis Resource (IEDB) bioinformatics team. The IEDB (http://www.immuneepitope.org) is an NIH-funded bioinformatics resource that aids in the development of vaccines, immunotherapeutics, and diagnostics, and assists scientists better understand immune mechanisms. Candidates will work with Dr. Bjoern Peters and Dr. Alessandro Sette (http://www.liai.org/pages/faculty) to analyze data and develop software tools to model immune responses. Candidates will have the opportunity to expand their knowledge and working experience in bioinformatics and immunology while working at one of the country’s top immunological research institutes.

REQUIREMENTS:

Interested candidates are required to have a PhD degree. The degree will ideally be in bioinformatics, but candidates with equivalent skills and interests in computer science, statistics, and biomedicine will be considered as well.

Experience with Python, Perl, R, Linux, Django, VMWare and Eclipse IDE is desirable, and background knowledge of immunology, biochemistry, and bioinformatics is a strong plus.

LOCALE: La Jolla, CA 92037

SALARY AND BENEFITS:
Salary will be commensurate with experience.

HOW TO APPLY:
Contact careers@liai.org

Homepage: www.liai.org

Director of COMPUTATIONAL BIOLOGY @ Key Genomics--Charlottesville, VA (US

2008-10-09T11:13:00.000+05:30

BACKGROUND:

Join Key Genomics as we build the best pharmacogenomic company in the world with one goal: improving human health through pharmacogenomics.

Our algorithms - generated through our COXEN technology - will be in use in molecular diagnostics, clinical trials, and drug discovery/development, in association with partners.

We are seeking computational biologists and statisticians at all levels to add to our team, including: Director of Computational Biology

RESPONSIBILITIES:

Lead and grow the development of Key Genomics' pharmacogenomics bioinformatics platform, COXEN.
Use COXEN to predict patient outcomes in critical cancers.
Work with pharmaceutical, biotech, and CRO partners to generate novel COXEN algorithms and apply existing algorithms across simultaneous projects.
Publish research findings.
Collaborate with Key Genomics' IT team to continually improve COXEN operations.
Participate in setting the Key Genomics research agenda.

REQUIREMENTS:

Strong computational biology or computational statistics backgrounds with a Masters degree or Ph.D. in statistics, bioinformatics, or computer science, or similar technical disciplines.
Experiences in some of the following areas: classification methods such as SVMs, Markov chain Monte Carlo, gene expression data analysis, and pathway modeling.
Statistical computing in R and programming capability in C, C++, and perl are also plus.
Significant biology, chemistry, or biochemistry coursework or experience.
A history of successful project leadership.
Good oral and written communications skills.
Ph.D. with industry experience is highly desirable.

PREFERENCES:

At Key Genomics, we are committed to maintaining an organization with energetic, growth-minded teammates who are continually challenged to make a difference. We are seeking individuals that have the right technical skills, attitude, and ambition to create a great pharmacogenomics company. Thus we are very selective in our hiring process, as we want to choose only the most qualified individuals to join our existing, extraordinary team.

LOCALE: Charlottesville, VA USA

SALARY AND BENEFITS:
Negotiable, to include benefits and substantial stock options.

HOW TO APPLY:
Email a CV to jobs@keygenomics.com or visit www.keygenomics.com

DEADLINE: ASAP.

BIOINFORMATICS Scientist @ Montana State University

2008-10-09T11:10:00.000+05:30

BACKGROUND:

Montana State University in Bozeman, MT is recruiting a staff scientist to join the newly established Bioinformatics Core Facility. The candidate will work with scientists within the Thermal Biology Institute and NSF-EPSCoR program seeking to characterize microorganisms discovered in Yellowstone National Park and will also work with Montana INBRE and COBRE scientists studying biomedically important pathogens of man and animals. The Bioinformatics Scientist will be an essential member of the Bioinformatics Core team, and will have the support of a systems administrator, web designer/database developer, and functional genomics core coordinator.

RESPONSIBILITIES:

Successful candidates must be comfortable working with both prokaryotic and eukaryotic biological systems, and be well-versed in open-source, web-based and command line bioinformatics applications.
Assist research groups with any of the following: sequence analysis, genome annotation, metabolic capacity, computational evolutionary biology, analysis of gene or protein expression, analysis regulation, protein structure or docking prediction, comparative genomics, or modeling biological systems.
Establish productive working relationships with the various user groups and aids in experimental designs that will involve computational approaches, assess the quality of input data, and actively assist researchers in the production of high quality results, and to provide feedback to improve protocols, methods and approaches.
Maintain current knowledge of computational biology and lead efforts where necessary to improve hardware and software capability for genomics and proteomics at MSU and to train users on the use of genome tools and provide guidelines for manual curation.
The Bioinformatic Scientist will configure (including scripting where necessary), run, and troubleshoot computational software and bioinformatic tools.

REQUIREMENTS:

The candidate should have MS plus substantially successful professional IT experience in mathematics, biology, bioinformatics, chemistry, physics, engineering, computer science, statistics or related technical field *** OR *** a PhD in computational biology or closely related field. The candidate should have demonstrated mastery of UNIX/Linux and proficiency with some combination of Perl, Python, Java/J2EE, C, C++ and extensive knowledge of relational databases, schemas, and SQL queries.

LOCALE: Bozeman, Montana

HOW TO APPLY:

For complete job requirements and application procedures go to: http://www.montana.edu/msuinfo/jobs/prof/. Reply To: Martha Peters, Search Support, 406-994-7658 (mpeters(at)montana.edu).

DEADLINE:

Screening of applications will begin September 26, 2008 and will continue until position is filled.

Director, BIOSTATISTICS--Philadelphia Area, PA (US)

2008-10-05T18:37:00.000+05:30

RESPONSIBILITIES:

Unique opportunity to oversee the biostatistics department of market leading specialty clinical technology and service provider focused on trial design optimization strategies related to randomization, drug management and array based diagnostics. Leverage a comprehensive understanding of biostatistics with particular expertise in Phase I-IV trial design to help clients apply progressive technology solutions and flexible trial design concepts to maximize the efficiency and effectiveness of clinical programs. Liaise with sponsor personnel as well as internal and external subject matter experts to publish and speak in support of innovative and progressive applications of statistical theory.

Join a growing and premier clinical trials technology services company well positioned in the pharma/biotech industry with a promising future!

LOCALE:

Yardley, PA (30 minutes North of Phildelphia; 20 minutes from Princeton, NJ)

SALARY AND BENEFITS:

Mid six figures plus attractive benefits & generous bonus

HOW TO APPLY:

Please email corporate recruiter at tony.roig@almacgroup.com or apply online at www.almacgroup.com click clinical technologies careers us yardley pa

DEADLINE:
Inquires accepted until position is filled.

SYSTEMS BIOLOGISTS @ Monsanto--Huxley, IA (US)

2008-10-05T18:35:00.000+05:30

BACKGROUND:

Monsanto Company, is a leading global provider of technology-based solutions & agricultural products & has been ranked as one of the TOP TEN employers in the biotechnology industry by Science Magazine.

RESPONSIBILITIES:

We are seeking a highly motivated and qualified scientist to work in a diverse and energetic working atmosphere. The candidate will use systematic and integrative approaches to accelerate discovery and delivery of high value, qualitative corn products via the breeding pipeline. The candidate will work within a team of scientists with large datasets, constructing QTL and gene networks to help drive breeding efforts. The candidate will also apply data mining methodologies and tools to various data types, including QTL, genomic, transcriptomic, metabolomic, proteomic, public literature, and other types, as well as developing and applying new methodologies to various breeding pursuits. Additionally, the candidate will work to create new tools for moving information to breeders and will interact closely with other teams and talent across Monsanto's research groups.

REQUIREMENTS:
The successful candidate will possess:

- PhD in plant sciences, biology, or statistics, with an emphasis on systems approaches.
- Computer skills to include statistical packages and database creation and/or querying, programming languages such as Perl, Java, C/C++, etc., as well as standard MS programs.
- Effective verbal and written communication skills
- Ability to work as part of a multidisciplinary multicultural corn research team.

HOW TO APPLY:

At Monsanto, we offer a highly competitive salary & benefits pkg.! To apply on-line visit the Careers section of our website at www.monsanto.com & search by req. mons-00009424. Monsanto values diversity & is an EOE. M/F/D/V

Computer Software Development & Data Analysis @ Boston College--Boston

2008-10-05T18:31:00.000+05:30

BACKGROUND:

The Marth laboratory (http://bioinformatics.bc.edu/marthlab) at the Boston College Biology Department develops DNA sequence analysis software for data from high throughput, next-generation sequencing machines (e.g. Roche/454, Illumina/Solexa, AB/SOLiD, Helicos/Heliscope). Driven by collaborative data mining projects with genome centers and genomics laboratories we are building base calling programs, high-performance DNA read mapping algorithms; software for single-nucleotide polymorphism detection, structural variation discovery, and sequence data visualization. We are currently extending our algorithms for transcriptome sequencing, epigenetic analysis, and complete, whole-genome mutational profiling of model organisms. The laboratory is a key participant in the international 1000 Genomes Project, and in next-generation sequence analysis training courses.

RESPONSIBILITIES:

We are currently recruiting several postdoctoral fellows with expertise in bioinformatics and / or computing. Our primary interest is in computational scientists with a strong interest in biological / genomic research. Postdocs in the laboratory are expected to lead the development of high-performance sequence data analysis software, and to participate in collaborative analysis projects that drive tool development. They will work closely with data producers, experimental collaborators and colleagues at sequencing machine manufacturing companies.

REQUIREMENTS:

A doctorate in science or engineering (e.g. biology, genetics, physics, mathematics, computer science, or electrical engineering) is required. Candidates with demonstrated bioinformatics software development expertise (especially C/C++) are preferred. We will also consider computational scientists from other fields (e.g. engineering, physics) who wish to transition into bioinformatics, as well as biologists who have working experience with Bioinformatics programming using e.g. PERL or PYTHON. Successful candidates will be joining researchers in a growing, vigorous computational biology program (http://bioinformatics.bc.edu) on the Boston College campus.

TERMS:

Applicants should submit their curriculum vitae (including a list of publications), a description of research interests, and contact information for three referees. Positions are available immediately. Applications will be accepted until the positions are filled.

LOCALE: Boston, MA (US)

SALARY AND BENEFITS:
We offer competitive salaries for qualified applicants.

HOW TO APPLY:
Materials should be sent to Ms. Diane Butera at buterada@bc.edu.

WEB Developer @ University of Maryland--Baltimore

2008-09-17T07:40:00.001+05:30

BACKGROUND:

An exciting opportunity exists to join the Bioinformatics department at the new Institute for Genome Sciences, a world class institute established to support genomic research to improve human health at the University of Maryland, School of Medicine and beyond. We intend to accomplish this goal by leveraging the expertise of our domain experts, computational scientists, engineers, a state-of-the-art computational facility, and our partnerships with other universities and organizations.

RESPONSIBILITIES:

Primary responsibilities for this position include development of web interfaces and maintenance of existing websites, including the institute’s intranet.

Essential Functions:
• Design and implementation of modern and appealing web interfaces
• Maintain, administer and extend the institute’s content management systems
• Maintain and upgrade existing web interfaces and web sites
• Keep abreast of the latest developments and trends in the web development industry

REQUIREMENTS:
Possess a bachelor’s degree in Computer Science, Information Systems, Human Computer Interaction or related field, or at least 2 years professional experience as a web designer/developer. Graphic artists/designers with significant web development experience are also encouraged to apply. One year of professional experience with Javascript development, preferred.

The preferred candidate will have:

- Experience with creating visually appealing and functional web interfaces to support business needs and enhance human usability
- Good understanding and ability to author, modify and maintain cascading style sheets (CSS)
- Superior level of ability with the leading commercial and open-source graphical software tools to create original, vibrant, attractive and visually appealing graphical elements for incorporation into web and other interfaces (e.g., Adobe Photoshop/Illustrator, Gimp, etc)
- Good understanding of the various X/HTML specifications, relevant W3C standards and how to implement conforming markup while maintaining a consistent look and feel across browsers and operating systems
- Possess a good understanding of cross-browser web development and rendering issues between the most common web browsers in use
- A high degree of knowledge of graphic design principles including color theory, layout, typography, etc…
- Good analytical, interpersonal, and communication skills
- Ability to work in a team environment and meet schedules
- Excellent organization and time management skills
- Experience with “Web 2.0” related technologies and frameworks (eg, DHTML, AJAX, Dojo, Prototype, Scriptaculous, etc)
- Proficient with Perl or another server-side, open-source web development language (eg, PHP, Ruby on Rails, Java/JSP, etc…)
- Ability to administer, modify and extend instances of the Drupal content management system
- Familiarity with a rich internet application framework (eg, Adobe Flash/Flex/Air, Microsoft Silverlight, Sun JavaFX, etc…)

SALARY & BENEFITS:

Hiring Range: Commensurate with education and experience

DEADLINE:
Filing Deadline: 9/20/08
Re-Posted Date: 7/23/08

HOW TO APPLY:

To learn more about the University of Maryland, Baltimore and to apply for this position, please visit our website at www.hr.umaryland.edu/careers

AA/EOE/ADA

Senior IT Specialist @ University of Maryland--Baltimore

2008-09-17T07:36:00.002+05:30

BACKGROUND:

An exciting opportunity to join the Informatics Department at the new Institute for Genome Sciences, a world class institute to support genomic, basic and translational research to improve human health at the University of Maryland School of Medicine and beyond. We intend to accomplish this goal by leveraging the expertise of our domain experts, computational scientists, and engineers, a state-of-the-art computational facility and our partnerships with other universities and organizations. This position has a lead role in the setup and management of a state-of-the-art computational facility at the new Institute for Genome Sciences (IGS). The computational facility will be built using the latest technologies in high-throughput and high-performance computers and an enterprise class storage system.

RESPONSIBILITIES:

Design, deploy, and maintain network equipment, desktops, servers, and storage systems.
Maintain and upgrade operating systems.
Install and configure third party applications.
Act as the senior technical specialist to partner with other technical staff in designing project scope, tasks, and plans for development of new systems or modifications to existing systems.
Develop, document, and test modifications, policies and procedures, and disaster recovery plans
Perform backups and data archival.
Provide technical support.

MINIMUM QUALIFICATIONS:

4 years of appropriate education, experience and/or training with networked centrally operated and supported computing systems. Bachelor’s degree and/or coursework in Computer Science or Information Systems preferred.
5 years of progressively responsible systems administrator experience

KNOWLEDGE, SKILLS, AND ABILITIES:

Expertise in at least 2 Unix/Linux operating systems: (RedHat/Suse/Solaris/AIX/HPUX)
Experience in Windows and Macintosh operating systems and integrating them in a Unix/Linux environment
Advanced expertise with enterprise class storage systems using technologies such as iSCSI, SAN, NAS and vendors such as EMC, StorageTek, IBM, and NetApp.
Expertise with wired and wireless networking hardware and architectures. Familiarity with Cisco switches, Virtual LAN setup and configuration, Virtual Private Networks, routing, IPV4, IPV6, etc.
Expertise with various protocols such as TCP/IP, ICMP, NFS, DNS, FTP, etc.
Expertise in system security, OS hardening and authentication protocols such as LDAP, Kerberos.
Proficiency in scripting languages such as Perl, Unix shell scripting (bash, csh, etc).
Ability to configure, compile, and install third party applications.
Familiarity with the LAMP stack and configuration thereof.
Proactively addresses intricate performance enhancement issues that have potential impact for the campus community.
Experience with various Mail Transfer Agents (MTAs), including (but not limited to) Microsoft Exchange as well as knowledge of the underlying SMTP protocol.
Ability to provide guidance and assistance to less experienced staff
Advanced analytical, interpersonal, and communication skills
Excellent organization and time management skills
Able to engage in end-user technical support when necessary

SALARY & BENEFITS:

Hiring Range: Commensurate with education and experience

DEADLINE:
Filing Deadline: 9/20/08

HOW TO APPLY:
To learn more about the University of Maryland, Baltimore and to apply for this position, please visit our website at www.hr.umaryland.edu/careers
AA/EOE/ADA

Bioinformatics Analysts I @ University of Maryland--Baltimore, MD (US)

2008-09-08T09:01:00.002+05:30

Bioinformatics Analyst I
SOM Institute of Genome Science

University of Maryland, Baltimore, Baltimore, MD

Requisition Number: 3315

BACKGROUND:

The newly created Institute for Genome Sciences is recruiting for a Bioinformatics Analyst. The institute was established to support genomic, basic and translational research to improve human health at the University of Maryland School of Medicine and beyond. We intend to accomplish this goal by leveraging a state-of-the-art computational facility, the expertise of our domain experts, computational scientists, engineers, and our partnerships with other universities and organizations. The selected Bioinformatics Analyst I will contribute to genomic research projects and scientific analysis of the data generated by those projects using a variety of database and software applications. Responsibilities include generating, annotating, gathering or analyzing data and preparing for further analysis, research, or publication.

RESPONSIBILITIES:

- Following established procedures or specific scientific protocols, add value to data generated by genome sequencing projects through assembly, annotation, curation, and quality assurance.
- Perform preliminary analysis of genomic data and format for use by other analysts or scientists.
- Integrate and analyze data from genome sequencing projects, functional genomics analysis, and other school of medicine research projects.
- Perform data mining and synthesis activities using various internal resources, public databases and publications.
- Organize genomic data with other relevant data types into databases, displays, or graphic presentations for publication and web presentation.
- Participate in community outreach and training.

MINIMUM QUALIFICATIONS:

- Bachelor’s degree in Life Sciences, including fields such as Biology, Molecular Biology, Genetics, Biochemistry, or Bioinformatics.
- Experience with Windows and UNIX-based operating systems.
- Knowledge of relational database management systems, e.g., MySQL, PostgreSQL, or Oracle

KNOWLEDGE, SKILLS, AND ABILITIES:

- Ability to effectively operate analysis software and manipulate data in a UNIX environment.
- Ability to learn additional computer skills quickly.
- Strong analytical skills and the ability to effectively solve problems within the scope of the position.
- Excellent oral and written communication, presentation and interpersonal skills.
- Able to document and describe routine processing.

SALARY & BENEFITS:
Hiring Range: Commensurate with education and experience

DEADLINE:
Filing Deadline: 9/20/08
Reposted Date: 7/23/08

HOW TO APPLY:
To learn more about the University of Maryland, Baltimore and to apply for this position, please visit our website at www.hr.umaryland.edu/careers
AA/EOE/ADA

Clinical Software Developer @ Bristol-Myers Squibb--Hopewell, NJ (US)

2008-09-08T08:58:00.000+05:30

RESPONSIBILITIES:

This position involves implementing IT projects that support genomic technologies across a number of functional areas, focused around Pharmacogenomics and Biomarker Discovery, but also possibly supporting Discovery and Toxicogenomics. The position will entail building strong relationships with these groups, and helping to assess their data management and analysis needs. It will also involve thedesign, implementation, and support of informatics solutions to meet those needs.

REQUIREMENTS:

A strong formal education in molecular biology, genetics, or a related field. Working experience and knowledge of the drug discovery and development process Extensive experience with capturing and analyzing business requirements in the drug research domain. Must have demonstrated experience interacting with scientists directly and building relationships across matrixed organizations. Demonstrated experience in developing robust, maintainable software o Must have workingexperience with standard software development methodologies and lifecycles o Must have knowledge of 21 CFR Part 11 requirements and the development of validated software systems for GLP GCP environments o Understanding of object oriented analysis and design is highly desirable. o Proficiency with Java and Perl is particularly desirable. o Background in statistical programming environments such as SAS and R is highly desirable. o A broad technical background is desirable, particularly hands on Unix and Oracle experience. Specific experience working inthe Clinical Genomics Biomarker Discovery domain, including o Familiarity withbiomarker discovery technology platforms expression analysis, genotyping, MS, flow cytometry, immunoassays, IHC, imaging, etc. o Experience with statistical analysis methods is desirable, particularly around genomic profiling datasets o Familiarity with clinical data management systems o Understanding of clinical genomics data management challenges, including data integration, data security concerns, and anonymization requirements

LOCATION: Hopewell, NJ

HOW TO APPLY:
Go online to http://www.bms.com/career/data/ and register to view current career openings and apply to Job Number #25388

Register your resume and create a search agent for interest in future openings.

Please be aware that you must apply online via our web site to be officially considered an applicant to any Bristol-Myers Squibb job posting.

Bristol-Myers Squibb Company is an Equal Opportunity Employer M/F/D/V

Research Statistician @ Abbott--Chicago

2008-09-08T08:56:00.000+05:30

Follow your aspirations to Abbott for diverse opportunities, competitive salaries, great benefits, a 401(k) retirement savings plan, a company paid pension plan and profit sharing, all with a company providing the growth and strength to build your future.

BACKGROUND:

Abbott is a global, broad-based health care company devoted to discovering new medicines, new technologies and new ways to manage health. Abbott products span the continuum of care, from nutritional products and laboratory diagnostics through medical devices and pharmaceutical therapies. Our comprehensive line of products encircles life itself ? addressing important health needs from infancy to the golden years. Abbott employs over 65,000 professionals who bring their passion to life in Abbott labs and offices across the globe. Abbott's corporate headquarters, located north of Chicago, near Waukegan, Illinois, has several openings for experienced Research Statisticians to management-level individuals to join Abbott's Scientific Data & Analysis group. Follow your aspirations to Abbott for diverse opportunities, competitive salaries, great benefits, a 401(k) retirement savings plan, a company-paid pension plan and a profit sharing plan, all with a company providing the growth and strength to build your future!

RESPONSIBILITIES:

Protocol Input, Randomization Schedule, and Database Activities:

- Works with project team to decide on appropriate study design and statistical methodology
- Responsible for comprehensive protocol review Responsible for randomization schedule, sample size and power calculations
- Responsible for assuring that data for statistical analyses are accurate
- Responsible for assuring consistency in CRF and database conventions for their projects/studies

Statistical Analyses:
- Responsible for implementation of protocol methodology and statistical analysis plans
- Responsible for the accuracy and timeliness of statistical input into reports or decisions
- Can propose alternative analysis strategies when changes to planned analyses are needed
- Responsible for computer programs that are accurate, efficient and well documented

Scientific Reports and Publications:
- Responsible for Statistical Methods section
- Responsible for accuracy of statistical tables and data listings, and accuracy of report text
- Identifies and corrects flaws in interpretation of results, inconsistency in presentation or inference
- Provides significant and timely input to the development of a report strategy

Consultation:
- Collaborates with peers to develop efficient designs, quality protocols and reports per agreed timelines
- Provides accurate and timely answers to routine questions, and knows where to obtain advice when nonstandard questions arise.
- Understands and complies with basic drug development principles.
- Keeps others informed on status of key project deliverables.
- Interacts effectively on a regular basis with statistical programmers, database programmers, and data management personnel.

Training, Supervision, Mentoring:
- Effectively mentors less experienced statisticians
- Can delegate assignments to a limited number of other statisticians and review their work so that project support is delivered on time with suitable quality
- Can provide formal training to statisticians and to non-statisticians on a limited basis
- Can contribute to key initiatives as well as to projects
- Can ensure compliance with Abbott conventions and standards.

REQUIREMENTS:
- MS in Statistics, Biostatistics, or related field with 6-9 years of experience in clinical studies.
- PhD in Statistics, Biostatistics, or related field, and 3-5 years of experience in clinical studies.
- Significant experience interacting with clinical research scientists required.
- Good communication skills essential, particularly in writing.
- SAS programming experience required.
- May hire individuals at a hire salary grade, depending on skills and experience.

Education:
MS/PHD in Statistics, Biostatistics, or related field

Abbott welcomes and encourages diversity in our workforce. EEO/AA

LOCALE: North Chicago, Illinois, United States

BIOINFORMATICS Postdoc for Immunology Applications @ LIAL--La Jolla, CA (US

2008-09-08T08:53:00.000+05:30

RESPONSIBILITIES:

We are looking for a talented and highly motivated Postdoc to join the Immune Epitope Database and Analysis Resource (IEDB) bioinformatics team. The IEDB (http://www.immuneepitope.org) is an NIH-funded bioinformatics resource that aids in the development of vaccines, immunotherapeutics, and diagnostics, and assists scientists better understand immune mechanisms. Candidates will work with the IEDB team to analyze data and develop software tools to model immune responses. Candidates will have the opportunity to expand their knowledge and working experience in bioinformatics and immunology while working at one of the country’s top immunological research institutes.

REQUIREMENTS:

Experience with Python, Perl, R, Linux, Django, VMWare and Eclipse IDE is desirable, and background knowledge of immunology, biochemistry, and bioinformatics is a strong plus.

SALARY & BENEFITS:

Salary will be commensurate with experience.

LOCALE:

La Jolla Institute for Allergy and Immunology (www.liai.org)

HOW TO APPLY:

Please submit resume, salary requirements & references to careers@liai.org

Post-doc Fellow in Protein Interactions and Human Diseases

2008-09-04T11:40:00.001+05:30

BACKGROUND:
A post-doctoral position in bioinformatics is available immediately at Donnelly Centre for Cellular & Biomolecular Research (CCBR) at the University of Toronto. The candidate will work on a funded project titled “Model Organism Interactomes and Human diseases”, in collaboration with other participating investigators including Shoshana Wodak, John Parkinson, Andrew Emili and Jack Greenblatt. The main objective of the project is to develop computational tools to investigate the interaction networks of human and mouse genes that are involved in key cellular processes, and their relation to complex diseases. The project will focus on the chromatin remodeling pathways and related processes associated with various forms of cancer.

Specifically, the candidate will work on the following aims: (i) Gene function prediction: Developing methods to build a repertoire of genes with related function in the chromatin modification machinery of human, mouse and other model organisms. (ii) Prediction of protein interactions and complex in mouse and human, with a focus on human diseases. (iii) Other aspects of computational biology involving protein interactions and diseases.

QUALIFICATIONS:
Successful candidates should be highly innovative and motivated individuals with experience in bioinformatics, with emphasis on function prediction, gene annotation, comparative genomics, and databases. He or she should have strong programming and database skills. The candidate should have excellent communication, presentation skills, and organization skills. The candidate will work closely with all the investigators in the project.

COMMUNITY:
The Donnelly CCBR is an interdisciplinary biomedical research centre located in the heart of Toronto’s research district. Our group has close collaborations with other proteomics, genomics and bioinformatics groups located in the centre and elsewhere in the university. Other participating PIs are located in the Hospital for Sick Children, Toronto.

HOW TO APPLY:
Applicants should forward a cover letter, a CV, a research statement and future plan, and the name and contact information of 3 references to Dr. Zhaolei Zhang (Zhaolei.Zhang@utoronto.ca) (URL: http://www.utoronto.ca/zhanglab/)

Computer Systems Engineer: High Performance & Grid Computing @ NIBR--Cambridge, MA (US)

2008-09-04T11:38:00.000+05:30

BACKGROUND:
Novartis Institutes of Biomedical Research (NIBR) is in the formative stages of developing a New Era of IT. Recently, NIBR realigned internal IT/informatics services to form a central scientific IT organization and filled a newly defined CIO position. Backed by increased investment in technology/capabilities with the freedom to make innovative technology and services decisions, this rapidly expanding IT organization is now positioning to deliver the systems and services that are critical to the future of NIBR. We are seeking innovative, collaborative and dedicated IT talent to complement our existing teams to assure success as NIBR IT moves further into this exciting new era.

NIBR has a new role open within the Advanced Computing Services group (ACS) . This entity is the user communities primary point of contact for all HPC and Grid computing at NIBR.

The group is responsible for the design, integration and support of the Scientific Computing environment which currently consists of a 220+ node linux cluster (600+ nodes worldwide), multiple SMP systems and the High Performance Storage infrastructure. In addition, the ACS provides expertise in developing, parallelizing and optimizing scientific applications and user code.

RESPONSIBILITIES:
- Support job submission and resource scheduling environment

- Develop, support and integrate internal and external applications into a global grid computing environment

- Support scientific groups as a consultant and solutions architect for mid to enterprise-scale scientific application deployments

- Mentor junior and mid-level System administrators in and around grid computing

- Interface with Linux/Unix and Storage engineering teams

- You must be able to develop, research, and persuasively present technical strategies and options to senior IT managers and scientific customer groups

REQUIREMENTS:
- Minimum: Bachelor's degree in computer science or a physical science or equivalent experience and a minimum of 4 years related experience.

- Must have a broad computational background, including knowledge of Unix, Linux and Windows and demonstrated programming experience with Fortran, C, C++, HPC algorithms, programming models, debuggers, and performance tools.

- Must work effectively with users, understand user needs, and show initiative, tact, and judgment in developing solutions for users.

Desired Skills:
- Experience working with scientific applications as a parallel programmer
- Experience administrating and integrating job schedulars (eg. SGE, LSF)
- Experience with workflow tools (eg. Pipeline Pilot, Knime or Taverna)
- Experience with and technical computing tools (eg. R, S-PLUS, MATLAB, OCTAVE)

BIOINFORMATICS Associate Research Scientist @ St. Jude--Memphis, TN (US)

2008-09-04T11:33:00.000+05:30

BACKGROUND:

St. Jude Children's Research Hospital, located in Memphis, Tennessee, is a premier center for research and treatment of potentially fatal childhood diseases, including cancer and certain blood, genetic, and immunodeficiency disorders. The hospital's mission is to advance cures, and means of prevention, for pediatric catastrophic diseases through research and treatment. St. Jude is dedicated to providing unsurpassed patient care and to advancing the health of children through biomedical research.

Currently, St. Jude Children's Research Hospital has an opening for a Bioinformatics Associate Research Scientist (Job Number 16844).

RESPONSIBILITIES:

The Bioinformatics Associate Research Scientist in the Information Sciences Department participates in data mining, data visualization, statistical analysis, experimental design, and database development. The incumbent provides research support to interdepartmental investigators and assists in training investigators and new users to use bioinformatics applications and databases. The Research Scientist participates in the bioinformatics group’s independent research and assists in preparing and submitting manuscripts for publication.

REQUIREMENTS:

PhD in Molecular Biology, Biochemistry, Bioinformatics or related field is required.
PhD, which must include research related to bioinformatics (such as analysis of sequence data, microarrays, SNPs, image data, proteomics data, or biological pathways; development of algorithms, statistical methods, or scientific software) or,
PhD with no bioinformatics research, then minimum of 2 years of pre-or postdoctoral experience in Computational Biology or Bioinformatics research is required.
Experience with programming languages such as Perl, C, or Java is required.

HOW TO APPLY:

St. Jude offers a positive working culture, professional advancement, & competitive compensation. Qualified applicants may apply for this position or others via our online process at www.stjude.org/jobs

www.stjude.org
An Equal Opportunity Employer

--

BIOINFORMATICS/Java Programmer @ NYU--New York, NY (US)

2008-08-27T11:25:00.000+05:30

BACKGROUND:

The NYU RNAi Core Facility at New York University School of Medicine seeks a Bioinformatics/Java Programmer to organize and direct staff in computing applications.

RESPONSIBILITIES:

Candidate will be responsible for developing and designing a web-interface for a Functional Genomics facility at the NYU School of Medicine; monitoring project status, identifying and resolving problems which may impact the project results; maintaining software and hardware; working with departmental leadership on developing and implementing policies; consulting with departmental leadership regarding application alternatives, security, software usage, capacity planning, training, recovery and backup procedures. Individual should be able to seamlessly interface biology with computational skills, plus all related duties.

REQUIREMENTS:

Individual should possess BS/MS in computer science, computational biology, or bioinformatics, and at least 2 years professional programming experience. Experience with multiple programming languages, mainly Java and Perl and knowledge of SQL and Oracle database is required. Must have experience with Unix, web development including CSS and HTML.

LOCALE: New York, NY

SALARY AND BENEFITS:

NYU Medical Center provides its staff with far more than just a place to work. Rather, we are an institution you can be proud of, an institution where you'll feel good about devoting your time and your talents. And just as our employees invest so much in us, we invest in our employees. We're pleased to have one of the most competitive compensation packages not only among New York's hospitals and healthcare institutions, but within the corporate sector as well.

We begin with exceptional medical, dental, and drug coverage. We enhance this basic coverage with comprehensive wellness programs, and supplement those with retirement investment and benefits plans, and generous paid time off allowances. Add to that a very attractive tuition program, and you'll see just some of the ways that NYU Medical Center demonstrates our commitment to our employees.

HOW TO APPLY:

For more information and immediate consideration, please send your CV to nyurnai@gmail.com.

Postdoctoral Research Position in Epigenomics--New York, NY (US)

2008-08-27T11:24:00.000+05:30

BACKGROUND:

A postdoctoral position is available in computational epigenomics in the laboratory of Professor Fatemeh Haghighi at Columbia University and the New York State Psychiatric Institute. The research is focused on the development and application of computational and statistical algorithms for epigenetic analysis of neuropsychiatric disorders. Studies involve bioinformatic analysis of data from whole genome DNA methylation profiles to detect differentially methylated regions associated with disease and their potential function through genomic datamining. Other large dataset discovery problems are also of interest including mRNA gene expression and histone methylation.

REQUIREMENTS:

Job requirements include a strong quantitative background with a Ph.D. in bioinformatics/computational biology, computer science, applied mathematics, statistics, or physics; and significant experience in scientific computation working on biological problems. Candidates with a Ph.D. in the biological sciences with strong quantitative training will also be considered. Priority will be given to candidates with demonstrated expertise in bioinformatics and database design, sequence analysis including database similarity searches, sequence alignments, as well as motif and evolutionary analysis. A good publication record is preferable.

The candidate must have a solid background in statistics (familiarity with R or S/Plus), knowledge of machine learning techniques, and programming expertise in Java and/or C++ and Perl. The selected candidate will be a highly motivated individual with excellent written and verbal communication skills, capable of working independently and within a larger multidisciplinary team. All applicants must currently be eligible to work in the U.S.

LOCATION: New York, NY, USA

TERMS: 2 years with possible extension.

SALARY AND BENEFITS:

Commensurate with qualification and experience.

HOW TO APPLY:

Applicants should send a curriculum vitae, a brief statement of research interests, up to three reprints/preprints, and arrange for three letters of recommendation. Application material should be sent by email (a single PDF file preferred) to haghigh@pi.cpmc.columbia.edu

BIOINFORMATICS DB Administrator @ Dana-Farber & Harvard--Boston, MA (US

2008-08-27T11:22:00.000+05:30

BACKGROUND:

The laboratory of X. Shirley Liu (http://liulab.dfci.harvard.edu/) invites applications for a full time Bioinformatics Database Administrator at the Department of Biostatistics and Computational Biology at Dana-Farber Cancer Institute and Harvard School of Public Health. The research in the laboratory focuses on the integrative modeling of transcription and epigenetic regulation. We develop algorithms for the analyses of transcription factor ChIP-chip (Johnson et al, PNAS 2006) and ChIP-seq (Zhang et al, submitted), nucleosome occupancy (Oszolak et al, Nat Biotech 2006) and epigenetics (Lupien et al, Cell 2008), transcription factor motif finding (Liu et al, Nat Biotech 2002) and regulatory mechanism modeling (Carroll et al, Nat Gen 2006).

RESPONSIBILITIES:

Responsibilities of the job include: design and implement high throughput genomics and transcription regulation database with web interface; develop full-fledged software tools to analyze high throughput genomics data; maintain lab computer cluster and webpage.

SALARY & BENEFITS:
We offer competitive pay and benefit program, in addition the opportunity for computational biology training, research and publication.

REQUIREMENTS:
Ideal applicant should have:
A. MS/MA degree or above in CS or related field
B. strong computer science background (in order of importance): database (mySQL), programming ((python | perl) & (Java | C | C++) & R), internet technology (Apache, CGI or PHP), Linux system administration
C. good communication and team-work skills
The following are helpful:
D. prior bioinformatics training
E. experiences with analyzing and managing high throughput data
F. familiar with UCSC Genome Browser

In addition, applicant must be able to visit Boston for interview without visa application.

HOW TO APPLY:

Interested applicants should submit a letter of interest, CV, and name and contact of three references to xsliu (At) jimmy (Dot) harvard (Dot) edu with subject line “Bioinformatics DBA application”.

Postdoc Position in COMPUTATIONAL BIOLOGY of Transcription Regulation

2008-08-27T11:20:00.000+05:30

DESCRIPTION:

The laboratory of Professor Xiaole Shirley Liu (http://liulab.dfci.harvard.edu/) invites applications for a 2-3 year postdoctoral position at the Department of Biostatistics and Computational Biology at Dana-Farber Cancer Institute and Harvard School of Public Health. The research in the laboratory focuses on the integrative modeling of transcription and epigenetic regulation. We develop algorithms for the analyses of transcription factor ChIP-chip (Johnson et al, PNAS 2006) and ChIP-seq (Zhang et al, submitted), nucleosome occupancy (Oszolak et al, Nat Biotech 2006) and epigenetics (Lupien et al, Cell 2008), transcription factor motif finding (Liu et al, Nat Biotech 2002) and regulatory mechanism modeling (Carroll et al, Nat Gen 2006). We are especially interested in computational analysis of high throughput genomic applications in cancer, autism, aging and stem cells.

REQUIREMENTS:
Ideal applicant should have:

A. a PhD degree in related field (physical sciences or biology)
B. strong programming skills: ((Python or Perl) and (C or C++ or Java) and R)
C. strong quantitative background (Bayesian network, HMM, differential\ equations, etc.) or computational genomics experiences (DNA sequence analysis, microarray analysis, etc.)
D. at least two first author papers (co-first author is OK) written in English in previous area of research with submitted, accepted or published status in journals or conference proceedings
E. good spoken and written communication skills

In addition, applicant must be able to visit Boston for interview without visa application.

HOW TO APPLY:

Interested applicants should submit a letter of interest, CV, and name and contact of three references to xsliu (At) jimmy (Dot) harvard (Dot) edu with subject line “Postdoctoral application”.

COMPUTATIONAL EXPERT @ Broad Institute of MIT

2008-08-26T20:34:00.000+05:30

RESPONSIBILITIES:

Develop algorithms to reconstruct an organism’s genome from millions or billions of tiny sequence bits. These data are becoming available now as a result of fundamental innovations in sequencing technology.

Biology background not required. We seek candidates having exceptionally deep computational understanding and abilities, who enjoy solving nearly impossible problems.

Position involves mixture of algorithm design and implementation, rapid prototyping on data sets, analysis of data sets, interaction with laboratory personnel, writing for internal use and publication.

Intense, exciting environment. Work as part of a four-person team in cutting-edge organization with over 100 world-class computational scientists, tackling a wide range of critical issues in genomics and biomedicine.

REQUIREMENTS:

Advanced degree in math or computer science, or comparable research experience. Experience/expertise in C++. Excellent oral and written communication skills. Capable of self-directed research within broader goals set by group.

HOW TO APPLY:

Candidates meeting this are strongly encouraged to apply, regardless of experience level or prior exposure to the field. Apply to us, the Broad Institute of MIT and Harvard, position mit-00005613 at http://www.broad.mit.edu/info/careers. We are an equal opportunity and affirmative action employer.

Director Global HEOR - Oncology

2008-08-21T08:25:00.001+05:30

RESPONSIBILITIES:
The Director, Global Health Economics and Outcomes Research - Oncology will be responsible for the following in support of assigned projects and products in the Pharmaceutical Products Group:

- Defines Global HEOR strategies for the & reimbursement and optimizing demand of Abbott's products
- Represents Abbott at HEOR meetings to present HEOR data needs.
- Identifies and obtain HEOR data needed, and ensures that they are effectively presented to the formulary & reimbursement agencies for the products.
- Advises on Global HEOR requirements for access and demand.
- Assesses HEOR programs against HEOR regulatory requirement.
- Obtains and coordinates HEOR input into R&D programs.
- Assesses scientific data by competitor drugs and develop HEOR data need for pricing and reimbursement purposes.
- Assures compliance of evidence-based medicine and sound principles for economic and PRO assessment.
- Maintains awareness of HEOR regulatory legislation and assesses its impact on business and Abbott product development programs.
- Must be able to translate HEOR strategic direction on drug from the quarterly meetings to business opportunities for franchise and clinical teams.
- Facilitates policy and development and standard interpretation of HEOR regulations.
- Manages the preparation of core HEOR registration and formulary packages and answers to deficiency letters.
- Maintains an awareness of HEOR regulatory legislation and assesses its impact on product development programs and compliance for marketed products.
- Represents Abbott at HEOR pricing and reimbursement agency meetings.
- Provides HEOR expertise to licensing departments.
- Ensures records of filings and approvals are maintained.
- Make sure the abstracts and manuscripts are not only submitted but also accepted for publication.
- Manages project and therapeutic area budgets.
- Has direct and indirect reports.

REQUIREMENTS:
Must have advance training in HEOR 7+ years of experience in pharmaceutical industry, CRO, academia or other health related consulting company. Must possess excellent technical and people management skills. Must have previous management and leadership experience.

Ph.D., MD or PharmD with training in health services research.

HOW TO APPLY:
Please copy/paste URL: https://sjobs.brassring.com/1033/ASP/TG/cim_jobdetail.asp?JobReqLang=1&type=search&JobSiteId=50&jobId=622741&PartnerId=281&siteid=50&recordstart=1

Bioinformatics Systems Programmer, GHBC Bioinformatics Core

2008-08-21T08:20:00.002+05:30

RESPONSIBILITIES:
A Bioinformatics Systems Programmer position is available in the Global Health Bioinformatics Core facility at Seattle Biomedical Research Institute (SBRI). This position is responsible for development of applications in support of SBRI's biotechnology cores. Reporting to the Director of Information Technology, the Bioinformatics Systems Programmer will coordinate with scientific and administrative staff to develop stable applications and databases, troubleshooting problems effectively when necessary, create and maintain applications to automate processes and biotechnology core workflows and provide database design and integration for scientific application systems.

REQUIREMENTS:
The ideal candidate will have 18 months to 3 years of IT/computing work experience with emphasis in the development of web-based applications and a BS degree required in Computer Science or related field. Experience in a scientific, academic or non-profit environment life is preferred. Other qualifications include but are not limited to:
- Proven development experience in .NET, ASP, C#, Java or Perl. Experience with Linux shell scripting, DOS batch, and/or other scripting languages desirable.
- Experience in HTML, CSS, JavaScript, DHTML, AJAX.
- Demonstrated ability to think both architecturally and operationally while completing application development projects.
- Experience in database design and the relational model. SQL programming and Perl DBI..
- Web programming experience connecting to SQL Server2000 and/or Oracle RDBMS databases including reporting queries and export/import routines.
- Familiarity with web-service architectures. XML, WSDL/UDDI and SOAP
- A true Customer Service mindset. Excellent interpersonal communication skills.
- Linux (or other Unix variant: Solaris, AIX, SCO, BSD) systems administration experience a plus.
- Experience with systems monitoring and management tools for Windows and Linux.
- Ability to organize and manage multiple projects with competing priorities.

BACKGROUND:
Nearly 250 scientists and staff members strive to combat global infectious disease each day at SBRI. By combining science and imagination, it is our goal to conquer the diseases (such as malaria, HIV) that are responsible for the majority of deaths worldwide. SBRI (http://www.sbri.org) is an independent, non-profit research institute that is affiliated with the University of Washington. SBRI occupies a new research facility that is in a fast developing Biotechnology hub in the South Lake Union area of Seattle that is home to many research organizations on the forefront of life sciences research.

SALARY & BENEFITS:
If you are looking for an opportunity to make a difference, SBRI is the place for you. In addition to an exciting work environment, we also offer a competitive benefits package that includes medical, dental, and vision coverage, as well as life insurance, disability insurance, retirement, vacation and sick pay.

HOW TO APPLY:
Apply online directly to the SBRI Job Postings webpage by clicking or typing this link: http://www2.ultirecruit.com/sea1003/jobboard/NewCandidateExt.aspx?__JobID=165
Visit our website to learn more about the labs and positions currently available: www.sbri.org.

SBRI is an Equal Opportunity Employer

BIOINFORMATICS/COMPUTATIONAL BIOLOGY

2008-08-21T08:16:00.001+05:30

OVERVIEW:
The Buck Institute seeks to recruit a Faculty member working in the area of Computational Biology and/or Bioinformatics. Outstanding junior or senior scientists are encouraged to apply. The appointment can be made at the Assistant/Associate or Full Professor level. Candidates with an interest in developing computational tools and applications for complex biological data analysis in systems biology, or cellular processes are particularly encouraged to apply. The successful candidate will play a leadership role in developing collaborative interdisciplinary programs with other Institute Faculty in areas including, but not limited to, the biology of aging, stem cell biology, and cancer and neurodegenerative disease.

LOCALE:
The Buck Institute is an independent research institute located 20 miles north of San Francisco whose research mission is to understand the mechanisms of aging and age-related disease. The Institute fosters an interdisciplinary and highly collaborative research environment, with expertise in chemistry, biology, proteomics, stem cells and model system genetics.

HOW TO APPLY:
To apply, please send (1) current curriculum vitae, (2) statement of research interests, (3) and the names of at least three references to:

Buck Institute for Age Research
Computational Biology Search Committee/HR
8001 Redwood Blvd.
Novato, CA 94945

Electronic applications can be sent to: hr@buckinstitute.org

Associate Research Scientist

2008-08-21T08:14:00.000+05:30

RESPONSIBILITIES:
The Compound Management Process Scientist will be responsible for the execution of the day to day procedures necessary to accomplish the business critical function of Compound Management. Responsibilities include the execution of work orders, tracking of metrics, Quality Control of instrumentation and communication with scientific community. Individuals who seek challenges in improving workflows and integrating automation equipment are preferred.

REQUIREMENTS:
B.S., or M.S. in Chemistry or Biology with 2 to 7 years experience in Compound Management preferred. Demonstrated record of competency in chemistry, high throughput screening, or compound management. Ability to follow complex workflows and procedures utilizing automated systems and liquid handling equipment. Demonstrated problem solving ability. Strong oral and written communication skills. Basic understanding of medicinal, synthetic and or combinatorial chemistry. Familiarity with chemical, biological information systems, especially database searching is preferred.

HOW TO APPLY:
To formally apply for this position, please go online to http://www.bms.com/career/data/. You may search for the position above by requisition number from the detailed search page. Please apply to requisition #25926.

Bioinformatician, Oncology @ Novartis Institutes

2008-08-16T10:54:00.001+05:30

DESCRIPTION
Novartis Institutes for BioMedical Research is Novartis' global research organization and is committed to discovering innovative medicines that cure disease and improve human health. By conducting more relevant and predictable drug discovery that can yield new and better medicines for patients, Novartis Institutes for BioMedical Research is redefining drug discovery in the post-genomic era.

Over the past four years, Novartis Pharmaceuticals has had the greatest number of new molecular entities approved by the US FDA. With its broad focus on diseases for which there is a need for better medical therapies, and with over 3,000 talented, dedicated research scientists worldwide, Novartis Institutes for BioMedical Research is well-positioned to ensure Novartis maintains its strong pipeline and highly successful track record in new drug discovery.

Novartis Institutes has sites in Cambridge, Massachusetts (headquarters); Basel, Switzerland; Horsham, UK; East Hanover, NJ; Vienna, Austria; Tsukuba, Japan and Emeryville, California. Novartis Institutes' Cambridge facilities encompass 950,000 square feet of laboratory and office space. Research in cardiovascular disease, oncology, infectious disease, diabetes, ophthalmology and muscle disease is headquartered in Cambridge. In addition, Cambridge is home to the following platform technologies: Global Discovery Chemistry, Functional Genomics, Developmental & Molecular Pathways, and Models of Disease Center.

In order to attract and develop an exceptionally talented and committed staff, Novartis Institutes for BioMedical Research offers an innovative and comprehensive benefits package, including healthcare, insurance, savings, retirement, and work/life benefits.

â??There is no greater privilege than to work towards bettering human health, and no more exciting arena in which to do so than through discovery of new medicines.â? -- Mark C. Fishman, President, Novartis Institutes for BioMedical Research

At the Novartis Institutes for BioMedical Research(NIBR), our culture of discovery is open, entrepreneurial, and collegial, unwilling to accept barriers or conventional wisdom. By hiring the best academic, biotech, and pharmaceutical trained talent, we have fostered an atmosphere for drug discovery where innovation is rewarded. We have created a dynamic and flexible culture that values and leverages each associateâ??s diverse background, unique style and wealth of experience.

Increased productivity and rapid expansionâ??coupled with dramatic advances in the biological/chemical sciences and supporting technologiesâ??have produced exponential growth in demand for instant and precise information access, sophisticated data analysis and visualization, and computing power/bandwidth. As a result, state-of-the-art research information technology (IT) capabilities must be in place to support, enable, and drive the companyâ??s innovative science.

NIBR is in the formative stages of developing a â??New Eraâ? of IT to meet this need. Recently, NIBR realigned internal IT/informatics services to form a central scientific IT organization and filled a newly defined CIO position. Backed by increased investment in technology/capabilities with the freedom to make innovative technology and services decisions, this rapidly expanding IT organization is now positioning to deliver the systems and services that are critical to the future of NIBR. We are seeking innovative, collaborative and dedicated IT talent to complement our existing teams to assure success as NIBR IT moves further into this exciting new era.

Bioinformatician/Oncology:

The NIBR IT organization has a need for a bioinformatician. In this role, you will be a critical part of the IT team supporting the Oncology therapeutic group.

Responsibilities:
â?¢ Actively work with scientists/computational biologists in the oncology area to understand their needs and provide appropriate informatics solutions
â?¢ Perform rapid prototyping to refine the requirements with proper documentation
â?¢ Work with internal and external software teams, where appropriate, to design proper solutions to meet scientistsâ?? needs
â?¢ Work either as a team member or lead teams to deliver solutions to the scientists/computational biologists
â?¢ Work effectively with different NITAS groups to ensure that solutions are effectively and efficiently implemented

REQUIREMENTS:
Qualifications: Bachelor's degree in computer science or equivalent and/or advanced degree in biology with strong computational skillsâ?¢ At least 3-5 years experience in application development in a drug discovery, scientific or biotech environmentâ?¢ Strong communications and interpersonal skillsâ?¢ Proven capabilities interacting with scientists and being customer service orientedâ?¢ Ability to work independently and/or as part of a teamâ?¢ Good understanding and practical experience in fundamentals of software engineeringâ?¢ Proficiency in SQL, solid understanding of relational databases, and familiarity with Oracle and/or SQL serverâ?¢ Basic understanding of Linux (or UNIX) systems administrationâ?¢ Familiarity with web development technologiesNovartis Institutes for BioMedical Research is an equal opportunity employer committed to embracing and leveraging diverse backgrounds. M/F/D/V Please visit http://www.novartisinstitutes.com/careers/

Bioinformatician - Ensembl Genomes

2008-08-16T10:48:00.001+05:30

Description :

The EBI is a world-leading bioinformatics centre providing biological data to the scientific community, with expertise in data storage, analysis and representation. Ensembl is one of the world leaders in vertebrate genome annotation and one of the key services of the EBI. We are currently in the process of extending Ensembl to cover a wider taxonomic scope (a project known as Ensembl Genomes); this will result in the launch of a number of new divisions of Ensembl (e.g. Ensembl Plants, Ensembl Fungi, etc.) later this year.

We are looking to recruit an additional developer to join the Ensembl Genomes team. We are members of a consortium committed to identifying genomic variation in Arabidopsis thaliana, and the primary responsibility of the successful applicant will be the development of a database to capture this information, based on established Ensembl technologies. The Bioinformatician will also be expected to contribute to the general development of Ensembl Plants.

The ideal candidate should possess a degree-level qualification in the computational or biological sciences; and at least two years experience of professional software development.
The post holder must be highly proficient in the use of relational databases (particularly MySQL) and be expert in the programming language Perl; ability in additional languages (e.g. Java) is desirable. Familiarity with the Ensembl system, genome annotation, or plant genetics, will be advantageous to applicants. Excellent communication, interpersonal and English skills are essential.

An initial contract of 2 years will be offered to the successful candidate. This can be renewed, depending on circumstances at the time of review.

For further information please visit http://www.embl.org and http://www.ebi.ac.uk

EMBL is an inclusive, equal opportunity employer offering attractive conditions and benefits appropriate to an international research organisation.

To apply, please email a cover letter, CV (in English) and contact information of three professional references quoting ref. no. AC/08/054/EBI in the subject line, to: applications@ebi.ac.uk
Deadline for applications : August 23, 2008.

Bioinformatician position

2008-08-16T10:34:00.001+05:30

BACKGROUND:

Monsanto Company, based in St. Louis, MO, is a leading biotechnology company and a global provider of technology-based solutions and agricultural products that improve farm productivity and food quality. As a Fortune 500 company, Monsanto has been ranked as one of the top ten employers in the biotechnology industry by "Science" Magazine.

RESPONSIBILITIES:

We are looking for a BIOINFORMATICIAN who will oversee data management, exploration, and mining of genomic and phenotypic data generated by Monsanto's transgenic plant pipeline. The new hire will work with the Data Mining and Integration group and automate loading and quality assurance for key phenotypic data types; design and build data query and visualization tools to explore phenotypic data in conjunction with genomic and systems biology data; and automate mining of the integrated datasets.

REQUIREMENTS:
The successful candidate will possess the following skills/experience:
- Excellent communication and problem-definition skills, to work with research groups that
will use mining tools and with IT, bioinformatics, and statistical groups that will help
implement them
- Broad range of technical skills, including:
-- Strong Perl programming skills are required, including object-oriented Perl.
-- Linux and Solaris experience
- Familiarity with at least one major toolset used for performing statistical analyses or
generating data graphics, including but not limited to SAS, S+/R, Spotfire.
- Candidates must have significant scientific programming in one or more of the following
areas: computational data mining, functional bioinformatics, high-throughput analysis and/or
general sequence analysis.
- Experiencing building relational databases and applications that use them, with Oracle
experience preferred.
- Experience with standard bioinformatics sequence analysis tools is desirable.
- Experience in building web-based applications or in at least one other object-oriented
programming language is desirable.
- Ph.D. or M.S. or equivalent in Biology, Bioinformatics, or Computer Science or other related
disciplines
- Experience in a research, agricultural, biotech or drug discovery environment specializing
in high throughput genomics or high-throughput screening is highly desirable
- Experience leading projects in a cross-functional environment is desirable

SALARY & BENEFITS:
At Monsanto, we offer a highly competitive salary & benefits package with career development opportunities in a team-oriented working environment.

HOW TO APPLY:
To apply on-line, please visit the Careers section of our website at http://www.monsanto.com and search by req. mons-00009116. Monsanto values diversity & is an equal opportunity employer.M/F/D/V

Computational Biologist / Bioinformatician

2008-08-16T10:31:00.000+05:30

Looking to spend time in an interesting location? SimuGen is a toxicogenomics company originating in Cambridge, now establishing some operations in Kuala Lumpur (Malaysia) with the aim of launching the first product from Malaysia within a year. It'll be a web-based tool using proprietary dose-response models of gene expression phenotypes from human cell cultures exposed to chemicals. The aim being to help pharma develop safer drugs. This has already attracted significant attention internationally, and the intention is to begin a collaboration with a large pharma company in the near future.

The company is looking for a highly driven, independent bioinfomatician / computational biologist to conduct the R&D through to product implementation in Malaysia. This post will last 8 months and may be suited to somebody who is technically very good but still junior in industry, looking for a shorter-term challange. However we would also consider somebody with more experience and ambitions of eventually leading much of the company's R&D as a 'product architect' in the UK or internationally. This has the potential to grow into an exciting position, with highly competitive rewards for achieving crucial company milestones. In the first instance the core expectations would be:

(1) Manage the quality control of all data (from benchtop to analysis).
(2) Do extensive literature and database searches for toxicicologically relevant candidate genes.
(3) Format and manage gene expression data for analysis.
(4) Work closely with the Chief Scientific Officer (based in the UK) and the S-plus server team to set up the web-tool for customers.
(5) Help manage the collaboration with the pharma company.

In terms of basic skills we are looking for:

(1) Gene expression analysis (microarrays, qPCR) - crucial
(2) Ability to do database and literature searches for candidate genes - crucial
(3) R programming skills - highly valued

The intention is to start this position in September, with a competitive salary based on experience.

Interested persons can contact Dr Wills (CSO) with informal inquiries at quin.wills@simugen.co.uk. A brief list of questions they might have, in addition to a very brief CV clearly demonstrating skill sets, project management and research potential would be most useful.We regret that we will not respond to queries where the candidate clearly does not have the correct background/skills.

Employer:
SimuGen is a toxicogenomics company originating in Cambridge, now establishing some operations in Kuala Lumpur (Malaysia) with the aim of launching the first product from Malaysia within a year. It will be a web-based tool using proprietary dose-response models of gene expression phenotypes from human cell cultures exposed to chemicals. The aim being to help pharma develop safer drugs. This has already attracted significant attention internationally, and the intention is to begin a collaboration with a large pharma company in the near future.

Lat Date:October 25, 2008

Biotech Associate 1 (5012BR

2008-08-12T21:31:00.000+05:30

Yale University offers exciting opportunities for achievement and growth in New Haven, Connecticut. Conveniently located between Boston and New York, New Haven is the creative capital of Connecticut with cultural resources that include three major museums, a critically-acclaimed repertory theater, state-of-the-art concert hall, and world-renowned schools of Architecture, Art, Drama, and Music.

RESPONSIBILITIES:
Collaborate with the Director of the Center in setting priorities for project development and expansion. Research and develop ideas for improvement of existing HTS equipment. Play a significant role in the development and ongoing implementation of scientific and operational plans for the HTS section. Participate in the design of projects. Establish reports relating to the work performed for each project involving the HTS suite and submitting them in a timely fashion. Responsible for maintaining and updating comprehensive SOP’s relating to the different procedures and protocols uses, implemented and/or developed in the HTS section. Have limited management of staff.

The Yale Center for HTS Biology performs automated high-throughput screening (HTS) on biological assays.

Position Description:
- Continually maintain several robust and flexible automated high-throughput screening platforms.
- Provide information and practical assistance to our informatics partners on a need-to basis as required to establish an integrated LIMS.
- Work with biologists and informatics in the Center to generate high quality products.
- Perform chemical screens in conjunction with lead scientists in an efficient, validated, modular manner.
- Perform siRNA screens in conjunction with lead scientists in an efficient, validated, modular manner.
- Perform Lentivirus production development in conjunction with lead scientists in an efficient, validated, modular manner.
- Perform Adenovirus production development in conjunction with lead scientists in an efficient, validate, modular manner
- Generate daughter libraries of master compounds, Lenti and Adeno virus libraries in accordance with safety handling procedures and scientific protocols.
- Maintain an inventory of resources related to the HTS section and continually re-stock consumables in a timely and cost efficient manner.
- Conduct research of similar fields and recommend best practice for work relating to HTS.
- Forecast time frames for projects, upgrades, maintenance and other HTS related activities.
- Verify and maintain accuracy of data, records of use of reagents such as compound libraries and siRNA libraries; submit reports to the Director in a timely fashion.
- Document each project in a modular fashion including modular SOPs

REQUIREMENTS:
- Master's Degree in Chemistry, Biology, Biochemistry or other related discipline and one year of experience; or an equivalent combination of experience and education.
- Experience with high-throughput screening on biological assays.

HOW TO APPLY:
For more information and immediate consideration, please apply online at www.Yale.edu/jobs - the STARS req ID for this position is 5012BR. Please be sure to reference source code IBIOI when applying for this position.

We invite you to discover the excitement, diversity, rewards and excellence of a career at Yale University. One of the country's great workplaces, Yale University offers exciting opportunities for meaningful accomplishment and true growth. Our benefits package is among the best anywhere, with a wide variety of insurance choices, liberal paid time off, fantastic family and educational benefits, a variety of retirement benefits, extensive recreational facilities, and much more.

Yale University is an affirmative action/equal opportunity employer. Yale values diversity in its faculty, staff, and students and strongly encourages applications from women and members of underrepresented minority groups.

Biotech Associate 2 (5011BR) Yale University--New Haven, CT

2008-08-12T21:30:00.000+05:30

Yale University offers exciting opportunities for achievement and growth in New Haven, Connecticut. Conveniently located between Boston and New York, New Haven is the creative capital of Connecticut with cultural resources that include three major museums, a critically-acclaimed repertory theater, state-of-the-art concert hall, and world-renowned schools of Architecture, Art, Drama, and Music.

RESPONSIBILITIES:
Provide management and high level technical automation skills to the new Yale Center for High Throughput Biology. Formulate and execute research plans relating to the set up and improvement of the HTS suite and related areas. Propose budgets; manage staff. Design, build and continually maintain several robust and flexible automated high-throughput screening platforms. Research and stay current with new technological advances in the field and recommend new technology and processes to the Director.

Position Description:
- Maintain an inventory of resources related to the HTS section and continually re-stock on consumables in a timely and cost efficient manner. Provide the information and practical assistance to informatics partners needed to establish an integrated LIMS (lab information management system).
- Negotiate contracts for maintenance and support against a pre-set budget.
- Conduct research of similar fields and recommend best practice for work relating to HTS. Keep up-to-date on advances in technology and make recommendations for new processes and technology.
- Perform chemical screens in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Perform siRNA screens in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Perform Lentivirus production development in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Perform Adenovirus production development in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Forecast time frames for projects, upgrades, maintenance and other HTS related activities.
- Generate daughter libraries of master compounds, Lenti and Adeno virus libraries in accordance with safety handling procedures and scientific protocols.
- Document each process and project in a modular fashion including modular SOPs. Provide technical assistance on high throughput automation and equipment maintenance, as requested.
- Present data at meetings and presentations in written and oral formats.
- Verify and maintain accuracy of data and records about use of reagents such as compound libraries and siRNA libraries; submit reports to the Director in a timely fashion.
- Use funds available from cost-savings generated within the HTS section to improve process and technology. Propose budget for projects and ongoing maintenance to Director.
- Plan and execute an annual budget for HTS in conjunction with the Director and business manager.
- Manage present and future staff; make recommendations about staffing.

REQUIREMENTS:
- Master's Degree in Chemistry, Biology, Biochemistry or other related discipline and three years of experience; or an equivalent combination-of experience and education.
- Master’s or Bachelor’s Degree in automation, robotics, computers or related or equivalent work experience.
- Preferred: Project and staff management experience.

HOW TO APPLY:
For more information and immediate consideration, please apply online at www.Yale.edu/jobs - the STARS req ID for this position is 5011BR. Please be sure to reference source code XXXXX when applying for this position.

We invite you to discover the excitement, diversity, rewards and excellence of a career at Yale University. One of the country's great workplaces, Yale University offers exciting opportunities for meaningful accomplishment and true growth. Our benefits package is among the best anywhere, with a wide variety of insurance choices, liberal paid time off, fantastic family and educational benefits, a variety of retirement benefits, extensive recreational facilities, and much more.

Yale University is an affirmative action/equal opportunity employer. Yale values diversity in its faculty, staff, and students and strongly encourages applications from women and members of underrepresented minority groups.

BIOINFORMATICS Developer @ Lockheed Martin--Bethesda/Rockville

2008-08-12T21:29:00.001+05:30

BACKGROUND:
We are currently searching for a Bioinformatics Software Developer to support the National Institutes of Health (NIH). This opportunity is a permanent, full-time position with Lockheed Martin and it is on-site at the NIH in Bethesda/Rockville, MD.

The candidate will operate in a multi-disciplinary group of scientists, software developers, and operations staff who provide support, training, consultation services and informatics tools to the research community in the areas of bioinformatics and computational biosciences. The successful candidate will be energetic, flexible, personable and highly creative. Candidates *MUST* have excellent communication and documentation skills.

MAJOR DUTIES AND RESPONSIBILITIES:
- Design, implement, test, deploy, and maintain bioinformatics applications (web-based or standalone) to meet the needs of the research community;
- Translate user requests into scripts to streamline research processes;

REQUIREMENTS:
Education and skills:
- Ph.D. (preferred) or M.S. (with equivalent work experience) in Bioinformatics, Computational Biology, Computer Science, or related computational discipline ;
- Initiative in experimenting with new technologies;
- Demonstrated ability to apply project management techniques to track, update, and generate reports for ongoing projects and support actions;
- Ability to work independently, be detail-oriented and have excellent analytical skills;
- Outstanding communication and interpersonal skills.
Documented expertise in the following areas required
- Object-oriented programming: Java, C# or Object-Oriented Perl;
- Relational database development and SQL query: SQL server or MySQL;
- Sequence analysis, alignment and database searches;
- Web development and Web Service implementation;
- Excellent user-interface design skills.

Experience with or extensive knowledge of the following a plus:
- High performance computing clusters;
- Mathematical analysis, modeling, and programming;
- Microsoft .Net Framework development

HOW TO APPLY:
Please send resumes to David Dowling, Sr, Recruiter Lockheed Martin. David.A.Dowling@lmco.com

Scientific Programmer @ The Rockefeller University

2008-08-12T21:26:00.000+05:30

BACKGROUND:
The Rockefeller University, a premier biomedical research institute located on Manhattan's Upper East Side seeks a Scientific Programmer to work in our Hospital Biostatistics Department. The successful candidate will perform programming, analysis, design, and support for phenotyping recording and analysis software toolset.

REQUIREMENTS:
Master's degree required; educational emphasis in bioinformatics preferred. Must have a strong understanding of basic biology, genomics, and ontology development, previous experience with bioinformatics, programming, and database work, and have strong computational skills, including data parsing, data analysis, and database implementation. Experience with PERL, R, SQL, and Python a plus. Must be able to review and synthesize scientific data, and communicate well in person and in writing.

SALARY & BENEFITS:
We offer an excellent benefits package, tuition reimbursement and a competitive salary. The Rockefeller University is located on Manhattan's Upper East Side, on a 15-acre campus, along the East River ( www.rockefeller.edu/views.php ).

HOW TO APPLY:
To apply for this position please visit us at www.rockefeller.edu/hr/jobs.php, keyword Scientific Programmer, or IRC 4941.

The Rockefeller University is an Affirmative Action/VEVRAA/Equal Opportunity Employer.

Postdoctoral Scientist in Computational Genomics

2008-08-05T19:50:00.002+05:30

LOCALE:
Department of Neurological Surgery, the Robert H. Lurie Comprehensive Cancer Center, Lurie Center for Cancer Genetics Research, and the Center for Genetic Medicine of Northwestern University Feinberg School of Medicine

BACKGROUND:
The Northwestern Brain Tumor Institute Basic and Translational Science Program is a leader in applying functional and computational genomics tools and network analysis to the pathobiology of human gliomas. The Northwestern Feinberg School of Medicine, the Robert H. Lurie Comprehensive Cancer Center, the Lurie Center for Cancer Genetics Research, and the Center for Genetic Medicine have committed significant, new laboratory space for a dynamic, integrative program focusing on translational and basic brain tumor research. In addition to an exciting work environment, we also offer a competitive salary and benefits package.

RESPONSIBILITIES:
The Northwestern Brain Tumor Institute Molecular Profiling and Research Program is recruiting an exceptional and highly motivated Postdoctoral Scientist to expand efforts in computational/functional genetics/genomics-based research, both basic and translational, addressing the molecular mechanisms of glioma evolution and resistance to therapy.

REQUIREMENTS:
We are interested in candidates with extensive experience in computational genomics/biostatistics, particularly the analysis of high-throughput genome-wide datasets (expression, gene copy number, SNP, loss of heterozygosity, methylation, microRNA) and the use of public genomic databases, such as TCGA, Cancer Genome Project, GDB, SMD, GEO, Array Express, and Celsius.

Positions are intended for outstanding candidates with proven research credentials. Postdoctoral candidates are expected to hold a doctoral (Ph.D.) degree in biostatistics. Candidates should have a strong desire to work in a multidisciplinary environment. We discourage applications to apply, who do not meet those qualifications.

HOW TO APPLY:
Interested Postdoctoral Scientist candidates should submit via e-mail an electronic copy of their curriculum vitae, a cover letter describing their past research experience, career goals and a statement of research interests, along with complete contact information for at least three references to:

Markus Bredel, M.D., Ph.D.
Director, Northwestern Brain Tumor Institute Research Program
j-renfrow@northwestern.edu

Northwestern University is an Affirmative Action/Equal Opportunity Employer. Hiring is contingent upon eligibility to work in the United States. Women and minorities are encouraged to apply.

Postdoctoral positions in BIOINFORMATICS

2008-08-05T19:48:00.000+05:30

Postdoctoral positions are available immediately at the Center for Bioinformatics, Department of Molecular Bioscience, University of Kansas.

RESPONSIBILITIES:
Projects will involve protein structure prediction (algorithm development), GPCR and membrane protein structure modeling, high resolution protein structure refinement, and protein docking.

REQUIREMENTS:
Candidates with experience in following fields are encouraged to apply:

- Protein structure prediction (including threading, ab initio modeling and high-resolution structure refinement)
- Protein sequence and structure alignments
- Protein-protein & protein-ligand docking
- New drug design

Strong candidates with interest in other bioinformatics related topics will be considered as well.

HOW TO APPLY:
To apply, please send your CV and a brief description to Yang Zhang (Email: yzhang@ku.edu)

Systems Analyst/Programmer IV, BIOMEDICAL INFORMATICS

2008-08-05T19:47:00.000+05:30

BACKGROUND:
Scisco Genetics Inc., a recent spin-off from the Fred Hutchinson Cancer Research Center, is seeking a senior software developer. The successful candidate will be part of a small team of developers and biologists and will be able to contribute to the design, implementation, and testing of a scientific data management and analysis application used for collecting, analyzing, reporting, and sharing genetic and genomic data.

The near term goals of the company are to establish software solutions for sale and support to the biomedical scientific community, especially as they relate to the acquisition and analysis of genetic data for application to clinical medicine. The Company will support the further technical development and deployment of software, called the Genetics Management System (GeMS), now in use in a number of independent research laboratories. This system includes tools for data acquisition, archiving, querying, retrieval, visualization, integration and management, web-based linkage tools for data sharing and tools for electronic communication, and new analytical tools for interpretation of complex DNA sequence data. Specific plans include improving existing tools and implementing new solutions for data analysis, extending GeMS to support new data models, improving the functionality towards interaction with other systems, and expanding the number of deployments. These efforts will engage the development and application of new biocomputing tools or technologies for particular areas of scientific opportunity in biomedical research.

Support for this opportunity is currently available for 3 years through funding from the National Institutes of Health. Long-term goals include establishing a successful company within the framework of opportunities now emerging for informatics solutions in support of biomedical applications, with specific emphasis on medical genetics.

REQUIREMENTS:
- Basic knowledge of Linux systems administration.
- At least 4-5 years experience developing Java/JEE applications.
- Understand Agile software development and apply it throughout the development life cycle. Able to design UML and ERD diagrams.
- Able to work independently, but also happy to work with and support fellow team members.
- Creative and interested in science. Desire to learn conceptually about state of the art applications of genetics and genomics in medicine.

Required skills:
- Languages: Java, XML, HTML
- Operating System: Linux
- Technologies: JEE, Struts
- Database: SQL, JDBC
- Tools: A Java IDE, source control concepts, unit testing tools, a UML tool

Bonus Skills:
- Languages: JavaScript, CSS
- Technologies: JBoss, Tomcat
- Database: PostgreSQL
- Tools: Eclipse, Subversion, Ant, Selenium
- Scientific background

RESPONSIBILITIES:
- Responsible for all aspects of the software development life cycle, from collecting software requirements to supporting a solution in production.
- Apply Agile software development skills to create software that works in a dynamic environment with changing requirements.
- Design, refactor, implement, test, and support software for a J2EE environment.
- Write maintainable, scalable, extensible software using open source tools.
- Participate in design and code reviews.

TITLE: Systems Analyst/Programmer IV

TERMS: Full time position

LOCALE: Seattle, WA

CATEGORY: Computers

SALARY & BENEFITS: Salary DOE+ excellent benefits

HOW TO APPLY:
Please email, fax or mail your contact information. The address for this position is: Human Resources, Scisco Genetics Inc., 7 Harrison Dr., #701, Seattle, WA 98109. Office hours: Monday - Saturday, 8:30 - 7:00.

Email: info@SciscoGenetics.com

Web Site: www.SciscoGenetics.com (under construction)

Scisco Genetics Inc. is an equal opportunity employer, committed to workforce diversity.

OPENING DATE: Today

CLOSING DATE: Until Filled

Proteomics Analyst @ Dartmouth Medical School--Dartmouth

2008-07-31T07:39:00.001+05:30

RESPONSIBILITIES:

Dartmouth Medical School and the Norris Cotton Cancer Center seek applicants for a computer programmer. The successful candidate will develop and implement programmatic workflows for a modern mass spectrometry-based proteomics research laboratory, including web interfaces for parallel computer-based spectral matching programs, web-based data browsing and results reporting tools, LC-MS data analysis and visualization tools, and integration of information display with database-based results management.

Proteomics research at the Norris Cotton Cancer Center includes developing and implementing novel mass spectrometry-based methods to improve our understanding of lung cancer, as well as to discover early signaling events in tumorigenesis that may serve as early diagnostic indicators of disease. Programming support for these topics is a critical component of successfully achieving our research goals.

Key accountabilities:

Develops new tools for proteomics workflows
Writes or adapts programs for laboratory use
Works in a team environment with faculty, staff, students and postdoctoral fellows, as well as system administrators, statisticians, and others associated with proteomics workflows
Participates in experimentation, data analysis and interpretation of proteomics datasets
Participates in a dynamic team environment of group education, assists with manuscripts, and general contributions to further knowledge within the group and Medical School

REQUIREMENTS:

Operational expertise in Linux/UNIX/Windows environments
Skilled in PHP/cgi, Perl, and other languages involved in web interface creation
Familiarity with C/C++ is desirable
Ability to work independently and apply critical thinking skills and novel programming solutions to problems
Excellent interpersonal skills and willingness to work as a team member
1 – 2 years of programming experience
Bachelor’s degree (or equivalent) in Computer Science or related discipline
Continuation of employment based on availability of grant funds

HOW TO APPLY:
Please send a copy of CV, and at least 2 letters of recommendation to scott.a.gerber@dartmouth.edu

Scott A. Gerber, PhD
Tel. (603) 653 3679

Computational Biologist/ Group Leader at MIT--Cambridge, MA (US)

2008-07-29T17:23:00.000+05:30

Apply your computing skills to DNA at MIT!

Have stellar computational skills, PhD or equivalent experience? Enjoy solving nearly impossible problems? We'll retrain you to work with cutting-edge DNA technology!

We find biomedical applications for new DNA sequencing instruments yielding billions of short DNA sequences like
AATGTAATTTCAAATGTTAGCTCATTTTTGTTAATG
We need you on our team to solve the hard mathematical and computational challenges using terabytes of these data. We invent algorithms, delve deeply in the data, code like crazy, help design laboratory experiments: we do whatever is needed to make the new technologies fulfill their promise to unlock the mysteries of genomics and biomedical research in critical areas like cancer, human genetics, infectious disease, antibiotic discovery, genome evolution, man's inhumanity to man, and the number 42.
We seek candidates from highly diverse backgrounds, industrial and academic. Mathematical and computational experience and excellence required, including superb C++ skills in a Linux or Unix environment. Biology training helpful but not required as you can learn on the job. Outstanding oral and written communication skills, joy in teamwork. A group leader position is also open for a candidate with proven leadership experience in computational science.
The Broad Institute of MIT and Harvard has an intense, exciting environment, world-class laboratory and computing facilities, hundreds of scientists tackling a wide range of critical problems in biology and medicine. Come join us!

HOW TO APPLY:
Applications should also be submitted through http://hrweb.mit.edu/staffing/.
Search for mit-00004694, mit-00004693, mit-00003916, and mit-00004577, Software Engineer, Computer Scientist, Computational Biologist, and Group Leader positions. We are an equal opportunity, affirmative action employer.

MIT is an equal opportunity/affirmative action employer. Applications from women, minorities, veterans, older workers, and individuals with disabilities are strongly encouraged.

The Broad Institute was founded to empower scientists of all kinds to work together on difficult, diverse, critical genomic and biomedical challenges. The Institute is a unique collaboration between the MIT and Harvard academic and medical communities, and it offers the security and benefits provided to all MIT employees, including:

- Competitive pay
- Medical, dental, life insurance plans
- 401(k) plan with matching contributions
- Tuition assistance plan
- Four weeks of vacation after one year
- T-Pass subsidy program
- Athletic and fitness centers
- Child care services

Join a team that works the way you've always wanted to work.

SENIOR RESEARCH FELLOWSHIP IN BIOINFORMATICS

2008-07-29T17:22:00.000+05:30

BACKGROUND
The Queensland Institute of Medical Research (QIMR) is one of the
largest medical research institutes in the southern hemisphere, with
programs in areas such as cellular and molecular sciences, epidemiology
and population health, cancer biology, biotechnology, infectious
diseases and vaccine development. Situated on the Herston campus in
Brisbane, it is closely affiliated with the major Queensland
universities and teaching hospitals in Brisbane.

The Institute has excellent research infrastructure including genomics
platforms and next generation sequencing. In addition to its basic
research activities, QIMR operates a Good Manufacturing Practice (GMP)
facility and is associated with a phase I clinical trials company
(Q-Pharm).

QIMR is seeking to enhance its scientific Faculty by offering a Senior
Research Fellowship to an individual with outstanding ability in the
area of Bioinformatics, Computational Biology or a related discipline.
The successful applicant will be required to provide strategic
leadership in Bioinformatics at the Institute and develop collaborative
links with scientists across a range of disciplines. In addition to the
Fellowship salary, scientific funding will be provided to the successful
applicant to assist him/her to establish their own research program
within the existing divisions of the Institute.

REQUIREMENTS
The successful applicant will be expected to obtain competitive grants
to support their own research program within 5 years. It is anticipated
that the Fellow will be eligible to hold an adjunct university
appointment.

SALARY AND BENEFITS
A Competitive Fellowship Package commensurate with qualifications and
experience will be offered. The package will include salary, on-costs
and travel. Attractive salary packaging and superannuation options also
apply.

HOW TO APPLY
Further Information is available from Professor Martin Lavin, Assistant
Director on (07) 3362 0341 or martin.lavin@qimr.edu.au

Applications should include curriculum vitae, proof of qualifications, a
5 year plan for research (no more than 5 pages) and the names and
contact details of five professional referees.

Please quote reference number 60/08 and send applications to:
vacancies@qimr.edu.au or: Human Resource Officer, Queensland Institute
of Medical Research, PO Royal Brisbane Hospital, QLD, 4029.

DEADLINE
Applications Close: 5:00pm Friday 5 September 2008

Research Associate Position in Gene Expression Analysis at the University of Alberta in Edmonton, Canada

2008-07-29T17:20:00.000+05:30

BACKGROUND:
A Research Associate position is available for up to five years at the University of Alberta in Edmonton, Canada in the area of bioinformatics / gene expression analysis. This position is part of a large collaborative project aimed at characterizing gene expression in pig and cow embryos. The position will involve the development of bioinformatics pipelines and databases for the analysis of gene expression data, DNA and protein sequences, and biological pathways. The candidate will have access to advanced computing facilities and will work closely with wet lab scientists and a biostatistician.

REQUIREMENTS:
- A PhD in bioinformatics, biology, biostatistics, or a related field.
- Strong programming skills in Perl, Java, or Ruby.
- Experience analyzing microarray data using R.
- Experience working with command-line bioinformatics tools and packages such as EMBOSS and BLAST.
- Experience with MySQL and web application development.
- Ability to work in a Linux/Mac OS X environment.
- Ability to work independently and creatively.
- Excellent communication and interpersonal skills.

SALARY AND BENEFITS:
Competitive salary and benefits package.

HOW TO APPLY:
Send a detailed CV to Paul Stothard (stothard@ualberta.ca). Use 'research associate position in bioinformatics (gene expression analysis)' as the subject of the email.

Research Associate Position in Bioinformatics at the University of Alberta

2008-07-22T10:37:00.000+05:30

BACKGROUND:
A Research Associate position is available for up to three years as part of a collaborative project aimed at developing genomic selection methods and tools for beef cattle at the University of Alberta in Edmonton, Canada. The position will involve the implementation and application of statistical and machine learning methods for predicting traits from genotype information. A database will also be created to facilitate data management and sharing. As part of the bovine genomics program at the University of Alberta, the candidate will have access to advanced computing facilities and will work with experts in the areas of genomics, quantitative genetics, molecular biology, and bioinformatics.

REQUIREMENTS:
- A graduate degree in bioinformatics, computer science, statistics, or a related field.
- Strong programming skills in Perl, Java, or Ruby.
- Experience with machine learning and applied statistics, and related software tools such as R, SAS, or MATLAB.
- Experience analyzing large biological data sets.
- Experience with MySQL and web application development.
- Ability to work in a Linux/Mac OS X environment.
- Ability to work independently and creatively.
- Excellent communication and interpersonal skills.

SALARY AND BENEFITS:
Competitive salary and benefits.

HOW TO APPLY:
Send a detailed CV and contact information for three references to Paul Stothard (stothard@ualberta.ca). Use 'research associate position in bioinformatics (genomic selection)' as the subject of the email.

SYSTEMS ANALYST/PROGRAMMER IV, BIOMEDICAL INFORMATICS

2008-07-22T10:34:00.001+05:30

JOB DESCRIPTION:

A newly formed company Scisco Genetics Inc. is seeking a full time senior software engineer. The successful candidate will be responsible for contributing to the architecture, design, implementation, and testing of state of the art software application suites used for collecting, analyzing, reporting, and sharing genetic and genomic data. He will work with an existing team of Java developers at the Fred Hutchinson Cancer Research Center in Seattle WA, who are collaborating with researchers in medical genetics there to develop innovative software solutions that meet the scientific and laboratory needs.

The near term goals of the company are to establish software solutions for sale and support to the biomedical scientific community, especially as they relate to the acquisition and analysis of genetic data for application to clinical medicine. The Company will support the further technical development and deployment of software, called the Genetics Management System (GeMS), now in use in a number of independent research laboratories. This system includes tools for data acquisition, archiving, querying, retrieval, visualization, integration and management, web-based linkage tools for data sharing and tools for electronic communication, and new analytical tools for interpretation of complex DNA sequence data. Specific plans include improving existing tools and implementing new solutions for data analysis, extending GeMS to support new data models, improving the functionality towards interaction with other systems, and expanding the number of deployments. These efforts will engage the development and application of new biocomputing tools or technologies for particular areas of scientific opportunity in biomedical research.

Support for this opportunity is currently available for 3 years through funding from the National Institutes of Health. Long-term goals include establishing a successful company within the framework of opportunities now emerging for informatics solutions in support of biomedical applications, with specific emphasis on medical genetics.

QUALIFICATIONS:

* Basic knowledge of Linux systems administration.
* At least 4-5 years experience developing Java/J2EE applications.
* Solid objected oriented analysis and design skills. Understands standard design patterns and best practices, especially as they relate to J2EE. Understands n-tier concepts.
* Solid testing, debugging, and profiling skills. Understands how to apply these in a J2EE environment.
* In depth experience with gathering abstract and changing requirements from users and ultimately delivering high quality software into production.
* Understand Agile software development and apply it throughout the development life cycle. Able to design UML and ERD diagrams.
* Able to work independently, but also happy to work with and support fellow team members.
* Creative and interested in science. Desire to learn conceptually about state of the art applications of genetics and genomics in medicine.

Duties:

Responsible for all aspects of the software development life cycle, from collecting software requirements to supporting a solution in production.
Apply Agile software development skills to create software that works in a dynamic environment with changing requirements.
Design, refactor, implement, test, and support software for a J2EE environment.
Write maintainable, scalable, extensible software using open source tools.
Design ERD and UML diagrams.
Participate in design and code reviews.

REQUIRED SKILLS:

Languages: Java, XML, HTML, JavaScript
Operating System: Linux
Technologies: J2EE, EJB, JMS, JDBC, JSP, Servlets, Struts
Database: Design, ERD, JDBC, SQL
Tools: A Java IDE, source control concepts, unit testing tools, a UML tool
Development: Agile Development, UML, OO A/D, N-Tier Concepts, performance and scalability

BONUS SKILLS:

Languages: DHTML, CSS, Perl, C, Python
Technologies: JBoss, Tomcat, Web services, Security
Database: PostgreSQL
Tools: Eclipse, CVS, Ant, JUnit, DBUnit, Cruise Control, Checkstyle, pgAdmin III
Scientific background

BUSINESS TITLE:

Systems Analyst/Programmer IV

JOB TYPE:

Full time position

SALARY AND BENEFITS:

Salary DOE+ excellent benefits

CLOSING DATE:

Until Filled

HOW TO APPLY:

Please email, fax or mail your contact information. The address for this position is: Human Resources, Scisco Genetics Inc., P.O Box 75105, Seattle, WA 98175. Office hours: Monday - Saturday, 8:30 - 7:00.

Email: info@SciscoGenetics.com

Web Site: www.SciscoGenetics.com (under construction)

Postdoc / RA position at the British Columbia Cancer Research Center-

2008-07-22T10:33:00.000+05:30

BACKGROUND:
Programming (e.g., Java) and or statistics (R)

RESPONSIBILITIES:

We have an immediate opening for a post-doctoral fellow or Research Associate in the bioinformatics/data mining/algorithm development areas at the British Columbia Cancer Research Center.

Our group is focused on applying bioinformatics techniques to flow cytometry (FCM) data. FCM is a technique that is widely used within the biomedical community for cancer, diagnosis, treatment and research and treatment involving stem cells as well as HIV/AIDS. New high throughput methods can generate data consisting of millions of multiparametric descriptions of individual cells and only rudimentary bioinformatics tools exist to manage and mine high throughput FCM data.

We are leading an international effort to develop a systemic approach to modeling, capturing, analyzing and disseminating flow cytometry data. We are also testing our high throughput analysis methods to analyze flow cytometry data on datasets from the BC Cancer Agency and the BC Children's Hospital.

The candidate will conduct innovative research with investigators at the BC Cancer Research Center and our international collaborators aimed at developing automated FCM data analysis approaches.

Familiarity with data clustering and classification algorithms is an asset, but not required.

TERMS:

2 years, renewable

LOCALE:

Vancouver, Canada. Close to Whistler and Seattle. We will help with immigration for successful candidates.

HOW TO APPLY:
Please forward a copy of your C.V./resume to Dr. Ryan Brinkman

(rbrinkman@bccrc.ca) including the names of three references. Within your email, briefly describe your general area of research interest, and a date (or range of dates) you are available to start on.

Individuals who are about to finish their graduate studies are also encouraged to apply. There is the possibility to start immediatly if desired.

ENCODE ANALYSIS @ EMBL-EBI

2008-07-22T10:31:00.000+05:30

The EBI is a world-leading bioinformatics centre providing biological data to the scientific community, with expertise in data storage, analysis and representation.

The ENCODE project is a leading-edge international collaboration to identify all functional elements within the human genome sequence. EBI leads the multi-site Data Analysis Centre (DAC) for the scale-up phase of the ENCODE project with the aim of conducting integrative analysis of whole genome consortium data. The current post will involve implementing infrastructure to assist with large-scale functional data analysis and conducting integrative analyses as determined by the needs of DAC and the consortium.

We are looking for a candidate who will have either a biological, computational or physics background; in the latter case, the candidate is expected to show considerable enthusiasm in bioinformatics. (S)he will have at least five years experience programming in Perl, Java or Python and the ability to work in a collaborative, multi-centre project. Experience in large-scale genomic analysis would be beneficial, as would a background in statistics.

The ideal applicant will have a proven track record of working on large-scale biological data analysis projects and understand the challenges posed by such collaborative projects, including flexibility, tight deadlines, and use of state of the art bioinformatics approaches. We expect the candidate to be able to show extensive bioinformatics experience, including experience with relational databases particularly mySQL, spot programming using an appropriate language such as Perl, Python or Java and familiarity with high throughput DNA sequencing data. Experience with the existing Ensembl code base and data analysis pipelines would be beneficial.

Excellent interpersonal and organisational skills are essential as the role will involve close liaison with other groups in the DAC as well as the members of the other Encode. The ability to present complex bioinformatics analyses in person and via teleconference will be invaluable.

An initial contract of 3 years will be offered to the successful candidate. This can be renewed, depending on circumstances at the time of review.

For further information please visit http://www.embl.org/ and http://www.ebi.ac.uk/

EMBL is an inclusive, equal opportunity employer offering attractive conditions and benefits appropriate to an international research organisation.

SOFTWARE ENGINEER (BIOINFORMATICS)

2008-07-22T10:29:00.000+05:30

The EBI is Europe's leading provider of information services to biological researchers in academia and industry. An integral part of this service is the archiving of nucleotide sequences into the European Nucleotide Archive. This service was pioneered by the EMBL Nucleotide Sequence Database (EMBL-Bank) that has grown to contain more than 215 billion sequenced bases in early 2008.

We are currently looking to recruit a highly motivated PERL developer into the EMBL-Bank team. The successful candidate is expected to maintain and refactor the existing pipelines for data loading and distribution in order to cope with developments in the data and increases in data volume. In addition to these core activities, (s)he will also have opportunities to interact with other projects and technologies.

The ideal applicant should hold a university degree in bioinformatics or computer sciences (with good knowledge of molecular biology) and have several years programming experience in a production environment. A strong command of Perl is required; previous experience with biological databases and experience with Java would be an advantage. Excellent communication, interpersonal and English skills are essential.

An initial contract of 3 years will be offered to the successful candidate. This can be renewed, depending on circumstances at the time of review.

For further information please visit http://www.embl.org/ and http://www.ebi.ac.uk/

EMBL is an inclusive, equal opportunity employer offering attractive conditions and benefits appropriate to an international research organisation.

BIOINFORMATICS Scientist @ The Children's Hospital of Philadelphia

2008-07-22T10:28:00.000+05:30

RESPONSIBILITIES:

Provide strong bioinformatics expertise. Consult with researchers on high throughput experimental design and optimization, data management and analysis. Perform project requirement analysis and provide pertinent user support. Conduct data mining and in depth study, pipeline, application and database development. Coordinate bioinformatics projects, and activities with other internal and external partners. Enable integration and construction of scientific databases and applications in a growing genomics, proteomics, systems biology and clinical research environment. Utilize standard technologies like ORACLE, XML and large flat file systems. Design, program, test, modify, enhance, maintain, and support applications. Apply sequence analysis methods, clustering algorithms, functional and statistical analysis methods. Assess computer hardware and software for scientific computing. Work in a team and learning environment and interact with experimental, bioinformatics and IT experts to contribute to cutting edge biomedical research and application at the Stokes Research Institute of CHOP.

REQUIREMENTS:

- Ph.D. in Bioinformatics, Computational Biology or closely related fields. Five (5) years bioinformatics development experience in a RD setting.

- Advanced skills utilizing and in depth knowledge of bioinformatics algorithms, tools and resources, e.g. sequence retrieval, alignment and clustering techniques, expression profiling and protein related analysis, major databases and standards in the field.

- Expertise on nucleic acid and protein databases both in flat file and relational forms. Fluency in ORACLE/SQL, JAVA, PERL, C, HTML, XML and etc. Strong working knowledge or training in advanced biomedical research. Proficiency in operating systems, UNIX, LINUX, Mac OS X, and Windows.

- Familiarity with PC/MAC hardware and software, e.g., databases and etc.

- Excellent interpersonal skills to interact with both research and technical staff.

- Ability to work independently and efficiently on multiple projects with minimal guidance while consistently exercising good judgment.

- Ability to learn new technology quickly, to write and implement complex computer programs.

- Ability to independently set up and maintain multiple computer systems including: cluster/server/workstation/PC/MAC.BACKGROUND.

HOW TO APPLY:
Please apply online at http://www.chop.edu.apply2jobs.com/index.cfm?fuseaction=mExternal.showJob&RID=15274&CurrentPage=1

2 Postdocs in Statistical Phylogenomics

2008-07-22T10:26:00.000+05:30

DESCRIPTION:

Two postdoctoral positions are available to work in a project funded by the European Research Council (ERC) on models of genome evolution and phylogenomics in David Posada's lab at the University of Vigo, Spain (http://darwin.uvigo.es). Initial appointments will be made for one year, with a possible extension to up to three years. Gross salary including benefits will be around 25-30 kEuros, commensurate with experience. Starting date is negotiable.

REQUIREMENTS:

Candidates should have a doctoral degree in Statistics, Mathematics, Computer Science, Biology, or related fields. Both positions are computationally oriented, and excellent programming skills are essential, especially in Perl, C and C++. Familiarity with parallel and distributed computing environments is convenient. Strong communication and teamwork abilities are key.

For one position the ideal candidate would have in addition demonstrable experience in the development of likelihood and MCMC Bayesian methods. Familiarity with evolutionary biology would be very convenient.

For the other position the ideal candidate would have in addition a very strong background in evolutionary genomics. Advanced statistical skills would be a plus.

APPLICATION:

Please send a letter of interest, C.V., and the names and contact details of two referees to David Posada at dposada@uvigo.es, indicating 'postdoctoral position in statistical phylogenomics' in the subject of the email. Questions and requests for more information should be directed at the same address. Review of applications will begin immediately, and continue until the positions are filled.

Bioinformatics Specialist@the Children's Hospital of Philadelphia-

2008-07-22T10:24:00.000+05:30

POSITION DESCRIPTION:

Multifaceted position with responsibilities in applications development and support, data analysis, project support, and database/system management.

Independently design, program, test, modify, enhance, maintain, and support applications, with immediate tasks of developing bioinformatics algorithms, tools, and methods for analyzing the large-scale and high throughput genotyping data for copy number changes.

Perform bioinformatics analyses for various projects, including data preparation, data analysis, data management, and writing of statistical results.

Work on other bioinformatics projects as needed and required.

Interact with end-users to facilitate data exchange and data analysis of these projects.

QUALIFICATIONS:

Master's degree in Statistics, Biostatistics, Bioinformatics, Computational Biology, computer science, or related fields.

KNOWLEDGE, SKILLS & ABILITIES

Strong genomic data analysis knowledge.

Strong programming skills in R and/or SAS, C/C++, Perl, SQL, PHP, Java, and HTML.

Experience with UNIX/LINUX strongly preferred.

Experience with applied statistics strongly preferred.

Experience with biological data management strongly preferred.

Familiarity with bioinformatics resources and software preferred.

Biomedical background desirable.

Ability to work independently and take initiative when necessary.

Be accountable and meet deadlines.

Excellent organization and communication skills.

HOW TO APPLY:
Please apply online at http://www.chop.edu.apply2jobs.com/index.cfm?fuseaction=mExternal.showJob&RID=13113&CurrentPage=1

2 postdocs in protein structure modeling and drug design.

2008-07-22T10:23:00.000+05:30

BACKGROUND:

Two postdoc positions are available in the state of the art research environment of the recently inaugurated Price Center for Translational Research of Albert Einstein College of Medicine to develop methods for protein structure modeling and design and for computational drug design.

RESPONSIBILITIES:

Main tasks involve developing custom optimization approaches, both on the level of developing novel algorithms and scoring functions, for protein structure modeling and design and for modeling protein-substrate interactions. The research environment is highly interdisciplinary with numerous collaborations with experimentalists.

REQUIREMENTS:

The ideal candidate holds a PhD degree in relevant fields (e.g. computational biology, chemistry, physics) and has an extensive computational background in scripting and programming languages, familiar with Linux operating system. Familiar with bioinformatics programs and applications and has a strong working knowledge of research concepts and techniques.

TERMS:
Full time

LOCALE:

Department of Systems and Computational Biology, and Department of Biochemistry, Albert Einstein College of Medicine, Bronx, USA

HOW TO APPLY:

Please send a detailed CV, three contacts for references by e-email to ( postdoc_2008 at fiserlab.org )

DEADLINE:
ASAP

Bioinformatics Postdoc Position Available in a Systems Biology Lab

2008-07-22T10:21:00.000+05:30

BACKGROUND:

A posdoc position is immediately available in the Institute of Plant Genomics and Biotechnology and Department of Plant Pathology and Microbiology at Texas A&M University. This will be one of three of four hires for our group. The general research area for our group is to employ the most up-to-date systems biology and metagenomics approaches to explore the plant, insect, and microbe interactions and to provide solutions for biofuels and bioproduct research. Specifically, the lab will focus on four directions at the initial stage. First, we will study plant insect interaction with systems biology approaches to identify the important components for plant defense. Second, we will use systems biology, computational biology, and modern structural biology approaches to address the impendent needs in bioenergy from the perspectives of feedstock and cellulase enzyme improvement. Third, we will aim to develop the newest platforms for systems biology and bioinformatics applications including plant interactome study, next generation sequencing analysis, biological network building, proteomics data analysis, and statistical analysis of gene expression data. We expect that these platforms will be directly applicable to the other three areas of our research. Fourth, we will start the new direction of metagenomics and metaproteomics analysis of insect-microbe mutualism with respect to interaction with plant host. The study also has an application perspective in bioenergy and is related to the plant insect interaction research. Overall, we expect the four directions will lead to synergistic and cross-disciplinary understanding of fundamental scientific questions in plant, insect, and microbe interactions, and solutions for the emerging problems in bioenergy. The group will have access to the world-leading state-of-the-art instruments and platforms to accomplish their mission. We have the Illumina Genome Analyzer as the next generation sequencing platform for genome analysis, the microarray system for transcriptome analysis, and LC-MS/MS system for proteome and metabolome analysis. In addition, we will have the basic computational infrastructure for bioinformatics and the HDX

mass spectrometry platform for protein structure-function relationship study. The PI has broad background in functional genomics, bioinformatics, mass spectrometry, and plant insect interaction.

RESPONSIBILITIES:

The position will be responsible for developing sequence analysis platform for next generation sequencing based on PI's previous work. He will also have opportunities in systems biology and proteomics platform development as well as

continuing PI's effort in statistical software development for different gene expression techniques. We expect that our lab will be a superb place for a bioinformatician since the group will generate large amount of 'omics' data for platform development and will provide numerous collaborative opportunities.

REQUIREMENTS:

He should be proficient in Perl programming and have experience with Java or C. We wish to invite somebody who has an enthusiasm for science and seeks a scientific career.

PREFERENCES:
N/A

TERMS: The position can be extended as a university staff position. The initial appointment is one year, but could be extended for a much longer period of time.

LOCALE:

Texas A&M University is one of the most prestigious public universities in US, and ranks 24th in total research expenditure among all US universities in 2007. The university provides substantial opportunities for a long-term career development due to the enormous resources available and the quite good reputation. The institute and the department have a friendly group of faculty and researchers that can stimulate creative thinking and productive collaborations. College station ranks among the most livable towns in US for its excellent public school system and very low living cost.

SALARY AND BENEFITS:

Depending on experience.

HOW TO APPLY:

For detailed information, please contact Joshua S. Yuan at syuan@utk.edu or 510-919-7668.

DEADLINE: N/A

Applications Engineer, BIOINFORMATICS, C/C++--Silicon Valley, CA (US)

2008-07-22T10:17:00.001+05:30

BACKGROUND:

My client is a privately held company offering a platform for computing acceleration based on custom programming of FPGAs. This approach provides supercomputing power for compute-intensive applications in industries such as bioinformatics, oil and gas, and finance. The platform consists of a Virtual Processor and an SDK which enable FPGAs to be programmed easier and faster than ever before possible.

RESPONSIBILITIES:

Currently, this company is seeking an Applications Engineer to support their growing customer base. Their primary function will be to help customers understand the new programming tools and the programming models so they can implement their own applications.

Primary responsibilities will include applications development, benchmarking, consultation and software technical support to scientists and users.

REQUIREMENTS:

Strong programming skills in Fortran or C/C++ with a emphasis on scientific applications.
Experience with genomics applications using BLASTN, Clusta, SSearch or other genetic sequencing tools.
Excellent customer skills.
Aptitude for problem solving and issue resolution.
Ability to work independently.

LOCALE: Silicon Valley, CA

SALARY AND BENEFITS:

Competitive Salary and Benefits, Stock Options, Flex hours.

HOW TO APPLY:
Email Bob@RMGrecruiting.com

Computer Scientist or Software Engineer. Node of Biomedical Informatic

2008-07-15T17:11:00.001+05:30

DESCRIPTION:
The node on Biomedical Informatics of the Spanish Institute of

Bioinformatics, “Instituto Nacional de Bioinformática (INB)”, is settled in the Research Unit on Biomedical Informatics (GRIB) (www.imim.es/grib), a joint unit of the IMIM-Hospital del Mar and the University Pompeu Fabra, which is located at the PRBB, Barcelona. The aim of the node is to develop strategies, methods and applications that facilitate the biomedical application of bioinformatics and other computational approaches, with the purpose of contributing to the prevention, diagnosis and treatment of human diseases. We require a highly motivated candidate that will be involved in the development of methods and tools that allow the integration and subsequent computational exploitation of biomedical information of diverse sources and heterogeneous nature. Competitive salary will be offered according to experience.

QUALIFICATIONS AND EXPERIENCE:

Applicants must hold a degree in Computer Science or have a proven record in software development. Advanced proficiency in Java, experience in web application development technologies and knowledge of Unix/Linux is essential. Experience with relational databases such as MySQL and

experience in Perl and R languages are desired. Knowledge of Java Spring framework would be a plus.

HOW TO APPLY:
Please send a CV (including names and addresses of referees) by email
to nuria.lopez@upf.edu

SYSTEMS BIOLOGY SCIENTIST

2008-07-15T17:02:00.000+05:30

COMPANY BACKGROUND:

Monsanto Company, based in St. Louis, MO, is a leading biotechnology company and a global provider of technology-based solutions and agricultural products that improve farm productivity and food quality. As a Fortune 500 company, Monsanto has been ranked as one of the TOP TEN employers in the biotechnology industry by "Science" Magazine.

DESCRIPTION:

We seek a motivated Scientist, at our St. Louis- Creve Coeur, location who will join our Systems Biology effort in using systematic and integrative approaches to accelerate delivery of agricultural biotechnology products. In this role the candidate will be involved in the construction and modeling of genetic networks from diverse genome-scale data sources, and subsequently deriving insights from the models to develop biological hypotheses. The candidate will apply and develop modern computational and data mining tools for integration of different types of genomic, genetic, evolutionary, and other biological data sources, including functional genomics, transcriptomics, metabolomics, proteomics, known pathways, literature mining, genetic mapping, and other measurements. Additionally, the selected individual will interact closely and work together with other teams to help apply gene network data to advance gene development pipelines.

QUALIFICATIONS:

The successful candidate will possess:
- Ph.D or equivalent in biology, computational biology or a related field
- 3+ years of experience in computational biology and data analysis
- Working knowledge of common bioinformatics tools and data analysis algorithms
- Familiarity with common algorithms for gene network construction, computational data mining, and common statistical analysis
- Strong interest and motivation in solving biological problems using computational approaches
- Fluency in Perl, Java, or C/C++, and the UNIX working environment
- Excellent communication and interpersonal skills and should be a strong team player who will work on collaborative projects within and across teams
- Proven research experience in the field of Systems Biology, automated text mining, and knowledge and experience with relational databases is highly desirable

At Monsanto, we offer a highly competitive salary & benefits package with career development opportunities in a team-oriented working environment.

HOW TO APPLY:
To apply on-line, please visit the Careers section of our website at www.monsanto.com and search by req. mons-00008731. Monsanto values diversity & is an equal opportunity employer. M/F/D/V

Bioinformatics Software Engineer

2008-07-15T17:01:00.000+05:30

BACKGROUND:

Agilent provides core electronic and bio-analytical measurement tools to advance the electronics, communications, life science research, environmental and petrochemical industries.

We're creating the tools and technologies that are changing the way we understand our world.

If you're creative, adaptive, willing to learn and have more fun than ever before - join Agilent today.
Visit www.jobs.agilent.com. Our people make the difference.
Agilent's pioneering spirit was kindled more than 60 years ago, when two engineers - Bill Hewlett and Dave Packard - invented the future in their garage.
In 1999, Agilent was spun off from Hewlett-Packard Company, and we have continued to support the values so important to the two visionary founders.
While, physically, we have outgrown HP's garage, we continue to live the values handed down from Bill and Dave: uncompromising integrity: trust, respect and teamwork: and innovation that makes a difference.

RESPONSIBILITIES:
Position: Software-Bioinformatics Engineer - Career Level

Agilent’s Life Sciences Solutions Unit designs and manufactures DNA oligonucleotide microarrays, reagents, and instruments. You will play a key role in the success of these products by your contribution to the computational and experimental selection of the DNA sequences that are printed on our catalog and custom arrays.

We are seeking a motivated and adaptable individual to join our team of informatics, software, and biology experts. Responsibilities will include design, development, and deployment of high-throughput bioinformatics and data analysis tools for microarray design. These tools will be used internally, and provided to our customers via the eArray web portal.

REQUIREMENTS:
Requires:
- BS/MS degree in computer science, engineering or equivalent. Phd High desired
- experienced in .NET, Java, Perl, and/or relational database programming.
- Knowledge of public biological databases and repositories, and common bioinformatics tools is also required.
- Experience with high-throughput computational environments is desirable,
- Experience with data analysis tools such as Matlab, Jmp, or R.
- Track record of success in delivery of software to internal and external customers is a plus.

Geo Location: Santa Clara, CA

TRAVEL:
10% of the time

LOCATION:
Santa Clara, CA.

SALARY AND BENEFITS:
Competitive

HOW TO APPLY:
http://www.agilent.apply2jobs.com/?FuseAction=mExternal.showLogin&RID=2022890&sid=700

POSTDOC Position in Structural Bioinformatics

2008-07-15T16:59:00.000+05:30

Postdoctoral positions are available at Center for Computational Biology and Bioinformatics, Indiana University School of Medicine and Indiana University School of Informatics to conduct theoretical and computational research in biophysics.

QUALIFICATIONS:

Qualified candidates should have a PhD in Chemistry, Physics, Biology, or a related field. Experience with theoretical/computational biophysics, statistical mechanics, and/or computer simulations is a plus but not necessary. However, strong mathematical and programming skills are essential.

The main area of our interest is bioinformatic and theoretical study of proteins and protein-ligand, protein-DNA interactions. (please visit http://sparks.informatics.iupui.edu for details).

HOW TO APPLY:

Please send your CV with cover letter, and the names, addresses, and phone numbers of two referees who are familiar with your work. Email to yqzhou@iupui.edu with plain text file or pdf file is preferred. Only STRONGLY motivated, creative, and hard-working person who want to be successful should apply. The university is an equal opportunity employer.

Scientific Data Analyst - NIH

2008-07-15T16:57:00.000+05:30

Digicon Corporation, established in 1985, is a full-service Information Technology Integrator and Provider servicing Network Engineering and Software Development to both government and commercial customers. Digicon employs approximately 300 employees throughout the Washington metropolitan area, as well as several other major cities across the nation.

We are currently in search of a Scientific Data Analyst for a position based at the National Institutes of Health (NIH) in Bethesda, Maryland. In particular, this work is for the NIH's National Human Genome Research Institute (NHGRI).

DESCRIPTION:

Candidates will be a detail-oriented scientific data analyst (biology focus) to assist in the implementation of a Web-based relational database in clinical research settings. The successful applicant will provide support and training to database users, work directly with database developers to address problems and make enhancement requests, and play a key role in gap analysis and the mapping of legacy data.

REQUIREMENTS:

• Proven critical-thinking skills and demonstrated ability to analyze and interpret biological experimental data.
• Strong interpersonal and communication skills with a cooperative service-oriented attitude.
• Demonstrated knowledge of human molecular genetics (taken classes, have degree in genetics, or hands-on research laboratory experience).
• Proficiency with Microsoft Excel or other spreadsheet applications.
• Fluency in both written and spoken English.
• Experience using Macintosh OS X operation system.
• Knowledge of relational database structure and terminology.
• Laboratory experience in molecular biology, genetics, or biochemistry.
• Experience using Structured Querying Language.

QUALIFICATIONS:

Bachelor’s Master’s Degree in Biology or a related field. .

All candidates must be able to pass a background investigation.

HOW TO APPLY:

Qualified candidates are asked to submit resume and salary requirements to Delfon McRae at delfon.mcrae@digiconasp.com.